Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI5418
Trapped Gene
Bat1a (ENSMUSG00000019432)
Vector Insertion
Chr 17: 35380396 - 35381080
Public Clones CSJ158 (baygenomics) CSJ293 (baygenomics) CSJ160 (baygenomics) CSJ152 (baygenomics)
CSJ156 (baygenomics) CSJ174 (baygenomics) P016H04 (ggtc) M020A06 (ggtc)
PST1835-NR (escells)
Private Clones OST338476 (lexicon) OST231616 (lexicon) OST206581 (lexicon) OST183754 (lexicon)
OST150985 (lexicon) OST150984 (lexicon)
Severity of mutation (?) Insertion after 16% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000544607 (Chr17:35380058..35380395 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000544607 (Chr17:35380058..35380395 +)
Downstram Exon
ENSMUSE00000142007 (Chr17:35381081..35381208 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000458344 Chr17:35378759..35378797 No primer for this exon
upstream ENSMUSE00000582651 Chr17:35378815..35380395 No primer for this exon
upstream ENSMUSE00000544607 Chr17:35380058..35380395 No primer for this exon

*** Putative Vector Insertion (Chr 17: 35380396 - 35381080) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000142007 Chr17:35381081..35381208 No primer for this exon
downstream ENSMUSE00000142000 Chr17:35381401..35381493 No primer for this exon
downstream ENSMUSE00000141998 Chr17:35383882..35384065 No primer for this exon
downstream ENSMUSE00000544600 Chr17:35385896..35386014 No primer for this exon
downstream ENSMUSE00000142006 Chr17:35388192..35388323 No primer for this exon
downstream ENSMUSE00000142002 Chr17:35389692..35389801 No primer for this exon
downstream ENSMUSE00000544596 Chr17:35389909..35390053 No primer for this exon
downstream ENSMUSE00000544595 Chr17:35390152..35390299 No primer for this exon
downstream ENSMUSE00000365269 Chr17:35390418..35390625 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTGACTGTGGCTTTGAGCAT Chr17:35380367..35380387 59.44 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTGACTGTGGCTTTGAGCAT Chr17:35380367..35380387 59.44 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000019432