Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI543
Trapped Gene
Nfya (ENSMUSG00000023994)
Vector Insertion
Chr 17: 48539906 - 48548950
Public Clones (sanger) (sanger) (sanger) BC0421 (sanger) (sanger) (sanger)
(sanger) BC0706 (sanger) (sanger) (sanger) (sanger) (sanger)
CSJ311 (baygenomics) RRS381 (baygenomics) RRS382 (baygenomics) XH740 (baygenomics)
RRS388 (baygenomics) P012E06 (ggtc) Q009A01 (ggtc) P107C07 (ggtc)
D015E05 (ggtc) (ggtc) W248E04 (ggtc) P143F07 (ggtc) E051A10 (ggtc)
P090D10 (ggtc) P107C07 (ggtc) P119H04 (ggtc) D105E10 (ggtc) (ggtc)
A032F04 (ggtc) P009F07 (ggtc) P102B07 (ggtc) D010B04 (ggtc) (ggtc)
A021A08 (ggtc) P143F07 (ggtc) E051A10 (ggtc) P078D08 (ggtc) P019B07 (ggtc)
P119A11 (ggtc) D015H09 (ggtc) (ggtc) W269C04 (ggtc) W223F05 (ggtc)
P102B07 (ggtc) D010B04 (ggtc) D010B04 (ggtc) A021E08 (ggtc) P136G07 (ggtc)
E038E08 (ggtc) IST14834A11 (tigm) IST14332F7 (tigm) IST13607E5 (tigm)
IST11582G1 (tigm) IST14885C5 (tigm) IST15051D10 (tigm) IST12208D4 (tigm)
IST14500G10 (tigm) IST14175F2 (tigm) IST14437G12 (tigm) IST14355B6 (tigm)
Private Clones OST283986 (lexicon) OST274841 (lexicon) OST266842 (lexicon) OST261991 (lexicon)
OST220324 (lexicon) OST193920 (lexicon) OST192290 (lexicon) OST191614 (lexicon)
OST135515 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000461831 (Chr17:48548951..48549090 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTTCAGATTCGCCATTTTGC Chr17:48549060..48549079 60.59 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000461831 (Chr17:48548951..48549090 -)
Downstram Exon
ENSMUSE00000315814 (Chr17:48539763..48539905 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTTCAGATTCGCCATTTTGC Chr17:48549060..48549079 60.59 45 GGCCACGTTAAGAGTCCTGA Chr17:48539821..48539840 60.26 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000461831 Chr17:48548951..48549090 GTTCAGATTCGCCATTTTGC Chr17:48549060..48549079 60.59 45

*** Putative Vector Insertion (Chr 17: 48539906 - 48548950) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000315814 Chr17:48539763..48539905 GGCCACGTTAAGAGTCCTGA Chr17:48539821..48539840 60.26 55
downstream ENSMUSE00000315649 Chr17:48538307..48538393 TACCTGGAGGGTCTGGACTT Chr17:48538285..48538304 58.59 55
downstream ENSMUSE00000137023 Chr17:48534975..48535121 GGGTTGGCCTGTTGATGTAA Chr17:48535034..48535053 60.76 50
downstream ENSMUSE00000137024 Chr17:48532746..48532877 TGATGATCTGCTGGGTTTGA Chr17:48532765..48532784 60.2 45
downstream ENSMUSE00000137020 Chr17:48532505..48532610 TCCCTGGACAGCAATCTGTT Chr17:48532562..48532581 60.66 50
downstream ENSMUSE00000137022 Chr17:48531665..48531831 GTCCACTGCTGGTTGTGTTG Chr17:48531708..48531727 60.2 55
downstream ENSMUSE00000137019 Chr17:48531201..48531374 CCTTCGTTCCTTTGGGATTT Chr17:48531179..48531198 60.29 45
downstream ENSMUSE00000137021 Chr17:48530574..48530675 GCCGAGACTCATGGAGGTAT Chr17:48530632..48530651 59.12 55
downstream ENSMUSE00000353117 Chr17:48526232..48528667 AAGGCAGCCAACTCTTTTGA Chr17:48527126..48527145 59.99 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAATAATCGCCTTGCAGCAC Chr17:48548882..48548902 60.24 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGGCACGGTGAGTATGAGG Chr17:48548937..48548957 60.68 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 AGCATCTCCTAATCGCCTTG Chr17:48549029..48549049 59.43 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 AAATCGTGACTGGGAAAACC Chr17:48549024..48549044 58.89 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000023994