Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI5443
Trapped Gene
Ppp1r2 (ENSMUSG00000047714)
Vector Insertion
Chr 16: 31254820 - 31258060
Public Clones XG039 (baygenomics) CSJ249 (baygenomics) CMHD-GT_367E8-3 (cmhd) CMHD-GT_367F6-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000702118 (Chr16:31258061..31258590 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGACAGTGCCTCCTGTGCTT Chr16:31258356..31258375 60.06 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000702118 (Chr16:31258061..31258590 -)
Downstram Exon
ENSMUSE00000339230 (Chr16:31251627..31254819 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGACAGTGCCTCCTGTGCTT Chr16:31258356..31258375 60.06 55 ACCCACCTCCATGGTTACAA Chr16:31252200..31252219 60.09 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000466452 Chr16:31274932..31275363 CGATCGTGGAAGAGGAACTG Chr16:31274934..31274953 60.79 55
upstream ENSMUSE00000652940 Chr16:31274932..31275078 CGATCGTGGAAGAGGAACTG Chr16:31274934..31274953 60.79 55
upstream ENSMUSE00000423486 Chr16:31265391..31265498 CATATCATCCCGCTGACAAA Chr16:31265438..31265457 59.5 45
upstream ENSMUSE00000423475 Chr16:31261316..31261393 GGTGACGATGAAGACGCCTA Chr16:31261367..31261386 61.21 55
upstream ENSMUSE00000423470 Chr16:31260660..31260754 GAGCCAAAGTATCGGACTCG Chr16:31260713..31260732 59.84 55
upstream ENSMUSE00000423462 Chr16:31258423..31258590 GCAGATGGAGACAGCATGAA Chr16:31258443..31258462 59.95 50
upstream ENSMUSE00000702118 Chr16:31258061..31258590 AGACAGTGCCTCCTGTGCTT Chr16:31258356..31258375 60.06 55

*** Putative Vector Insertion (Chr 16: 31254820 - 31258060) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000339230 Chr16:31251627..31254819 ACCCACCTCCATGGTTACAA Chr16:31252200..31252219 60.09 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCTCAGCTCTGTCACTGTGG Chr16:31258022..31258042 59.76 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCTCAGCTCTGTCACTGTGG Chr16:31258022..31258042 59.76 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000047714