Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI5456
Trapped Gene
Ankle2 (ENSMUSG00000029501)
Vector Insertion
Chr 5: 110663840 - 110665291
Public Clones CSJ252 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 25% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000444642 (Chr5:110663366..110663839 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGTGGACGGGAAACAAACT Chr5:110663609..110663628 60.01 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000444642 (Chr5:110663366..110663839 +)
Downstram Exon
ENSMUSE00000444634 (Chr5:110665292..110665498 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGTGGACGGGAAACAAACT Chr5:110663609..110663628 60.01 50 CACTGCCTTCACAGGAGACA Chr5:110665473..110665492 60.02 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000444655 Chr5:110660060..110660442 No primer for this exon
upstream ENSMUSE00000444642 Chr5:110663366..110663839 CTGTGGACGGGAAACAAACT Chr5:110663609..110663628 60.01 50

*** Putative Vector Insertion (Chr 5: 110663840 - 110665291) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000444634 Chr5:110665292..110665498 CACTGCCTTCACAGGAGACA Chr5:110665473..110665492 60.02 55
downstream ENSMUSE00000540519 Chr5:110666674..110666870 GGGTACGGGGGTTTTTGTAA Chr5:110666751..110666770 60.8 50
downstream ENSMUSE00000298893 Chr5:110666966..110667154 AGGATGCGCTTCTGTAGCAT Chr5:110667117..110667136 60.01 50
downstream ENSMUSE00000189570 Chr5:110670948..110671070 TCGGTTTTTCACAATCAAAGG Chr5:110671042..110671062 59.96 38.1
downstream ENSMUSE00000189574 Chr5:110673523..110673589 AGTGCTGGAGATTTGTTTTGG Chr5:110673562..110673582 59.23 42.86
downstream ENSMUSE00000189571 Chr5:110678350..110678519 TCTGGGGCTGCTTCTACAGT Chr5:110678471..110678490 60.01 55
downstream ENSMUSE00000189576 Chr5:110679720..110679826 TGCTTTCTTTCGAGGTGGAG Chr5:110679770..110679789 60.51 50
downstream ENSMUSE00000189577 Chr5:110680516..110680706 AGTCTTTGCAAGCCTTCCTG Chr5:110680614..110680633 59.62 50
downstream ENSMUSE00000298853 Chr5:110681731..110682361 TCAGTTGTGGGCTGACTCTG Chr5:110681860..110681879 60.02 55
downstream ENSMUSE00000540517 Chr5:110681731..110681816 TAGAAATGCTCCCACGGAGA Chr5:110681780..110681799 60.73 50
downstream ENSMUSE00000540514 Chr5:110682051..110682361 TTGAAGGAAGCACCTCATCC Chr5:110682153..110682172 60.19 50
downstream ENSMUSE00000189578 Chr5:110682802..110682933 TGTGGATTGCTGGGTACAGA Chr5:110682890..110682909 60.11 50
downstream ENSMUSE00000298834 Chr5:110683320..110685666 GATGGCTCGGGTAAAACTCA Chr5:110685445..110685464 60.07 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATATGAGGATGGCCCTGTGA Chr5:110663815..110663835 60.3 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCTTCGTGACTGGGAAAACC Chr5:110663887..110663907 60.09 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029501