Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI5483
Trapped Gene
Fus (ENSMUSG00000030795)
Vector Insertion
Chr 7: 135111014 - 135111092
Public Clones YTA011 (baygenomics) M052A07 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000632278 (Chr7:135111015..135111091 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGGTCGTCTGGAACTTTGTT Chr7:135111026..135111045 60.15 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000632278 (Chr7:135111015..135111091 +)
Downstram Exon
ENSMUSE00000720474 (Chr7:135111015..135111091 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGGTCGTCTGGAACTTTGTT Chr7:135111026..135111045 60.15 50 AAGCAACAAAGTTCCAGACGA Chr7:135111051..135111071 59.91 42.86

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000669224 Chr7:135111004..135111091 CGGTCGTCTGGAACTTTGTT Chr7:135111026..135111045 60.15 50

*** Putative Vector Insertion (Chr 7: 135111014 - 135111092) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000632278 Chr7:135111015..135111091 AAGCAACAAAGTTCCAGACGA Chr7:135111051..135111071 59.91 42.86
downstream ENSMUSE00000720474 Chr7:135111015..135111091 AAGCAACAAAGTTCCAGACGA Chr7:135111051..135111071 59.91 42.86
downstream ENSMUSE00000393851 Chr7:135113076..135113100 No primer for this exon
downstream ENSMUSE00000469409 Chr7:135113231..135113385 CTGGCCGTATCCTGAAGTGT Chr7:135113351..135113370 60.13 55
downstream ENSMUSE00000203516 Chr7:135115352..135115496 AGGACTGCTGCCCATAAGAA Chr7:135115450..135115469 59.84 50
downstream ENSMUSE00000337099 Chr7:135115355..135115496 AGGACTGCTGCCCATAAGAA Chr7:135115450..135115469 59.84 50
downstream ENSMUSE00000287159 Chr7:135115631..135115818 TGTCCGTAGCTTTGTTGCTG Chr7:135115732..135115751 60.05 50
downstream ENSMUSE00000669220 Chr7:135115631..135115797 TGTCCGTAGCTTTGTTGCTG Chr7:135115732..135115751 60.05 50
downstream ENSMUSE00000287152 Chr7:135116068..135116284 GCTTCGGTTGTAACCACCTC Chr7:135116228..135116247 59.6 55
downstream ENSMUSE00000203510 Chr7:135117914..135117948 No primer for this exon
downstream ENSMUSE00000482093 Chr7:135119402..135119434 AGATCCTTGATCCCGAGGAC Chr7:135119424..135119443 60.42 55
downstream ENSMUSE00000203506 Chr7:135120732..135120835 GCCTTGCACGAAGATGGTAT Chr7:135120775..135120794 60.1 50
downstream ENSMUSE00000468370 Chr7:135121655..135121784 CCTTCAACTTGCCAGTTTCC Chr7:135121724..135121743 59.71 50
downstream ENSMUSE00000203531 Chr7:135123406..135123507 ACCCCGATTGAAGTCAGCTC Chr7:135123476..135123495 61.57 55
downstream ENSMUSE00000500432 Chr7:135123637..135123760 AGTCTCCAGCTCGTTGCTGT Chr7:135123747..135123766 60.21 55
downstream ENSMUSE00000669219 Chr7:135123709..135123760 AGTCTCCAGCTCGTTGCTGT Chr7:135123747..135123766 60.21 55
downstream ENSMUSE00000386530 Chr7:135124705..135124805 AGGTGCCTTACACTGGTTGC Chr7:135124765..135124784 60.18 55
downstream ENSMUSE00000388669 Chr7:135124925..135125069 CCACGTCGATCATCTCCATA Chr7:135124955..135124974 59.48 50
downstream ENSMUSE00000632277 Chr7:135125305..135125546 GCCAGGCTAATATGGCCTCT Chr7:135125353..135125372 60.57 55
downstream ENSMUSE00000669225 Chr7:135125305..135125543 GCCAGGCTAATATGGCCTCT Chr7:135125353..135125372 60.57 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTCTGGAACTTTGTTGCTTGG Chr7:135111032..135111053 59.77 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTCTGGAACTTTGTTGCTTGG Chr7:135111032..135111053 59.77 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000030795