Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI5500
Trapped Gene
Phf3 (ENSMUSG00000048874)
Vector Insertion
Chr 1: 30894112 - 30919831
Public Clones (sanger) (sanger) YTA058 (baygenomics) CSH429 (baygenomics) RRR590 (baygenomics)
D029A01 (ggtc) D161G05 (ggtc) Q009E02 (ggtc) D058D11 (ggtc) Q009B07 (ggtc)
M122H04 (ggtc) D036H02 (ggtc) P032C11 (ggtc) D161G05 (ggtc) (ggtc)
W269E04 (ggtc) D058D11 (ggtc) D036H02 (ggtc) M122H04 (ggtc) M122H04 (ggtc)
D107C06 (ggtc) W254A01 (ggtc) D036H02 (ggtc) IST14621B10 (tigm) IST10726F8 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 4% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000630485 (Chr1:30919832..30920101 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCAATGATCCCAATTTCCAG Chr1:30919848..30919867 60.27 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000630485 (Chr1:30919832..30920101 -)
Downstram Exon
ENSMUSE00000630484 (Chr1:30893950..30894111 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCAATGATCCCAATTTCCAG Chr1:30919848..30919867 60.27 45 TGTGCCATTAAACGAGGTGA Chr1:30893930..30893949 60.11 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000630485 Chr1:30919832..30920101 GCAATGATCCCAATTTCCAG Chr1:30919848..30919867 60.27 45

*** Putative Vector Insertion (Chr 1: 30894112 - 30919831) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000630484 Chr1:30893950..30894111 TGTGCCATTAAACGAGGTGA Chr1:30893930..30893949 60.11 45
downstream ENSMUSE00000315372 Chr1:30886705..30887316 GCTCACCAGAATTTCGCTTC Chr1:30887252..30887271 59.96 50
downstream ENSMUSE00000630482 Chr1:30886688..30886702 No primer for this exon
downstream ENSMUSE00000630483 Chr1:30886688..30888404 CCTCACCATAGCCCAGTGTT Chr1:30887618..30887637 59.99 55
downstream ENSMUSE00000604101 Chr1:30881055..30881364 CCATTTGCTGTGCTTGAGAA Chr1:30881260..30881279 59.99 45
downstream ENSMUSE00000630481 Chr1:30881055..30881364 CCATTTGCTGTGCTTGAGAA Chr1:30881260..30881279 59.99 45
downstream ENSMUSE00000468070 Chr1:30877976..30878159 TCCGAGGTAAATGTGGTTGG Chr1:30878035..30878054 60.74 50
downstream ENSMUSE00000630480 Chr1:30877976..30878159 TCCGAGGTAAATGTGGTTGG Chr1:30878035..30878054 60.74 50
downstream ENSMUSE00000315471 Chr1:30877528..30877672 AGGCTTGGAAGTAGCAGCAG Chr1:30877565..30877584 59.78 55
downstream ENSMUSE00000702069 Chr1:30877528..30877672 AGGCTTGGAAGTAGCAGCAG Chr1:30877565..30877584 59.78 55
downstream ENSMUSE00000315459 Chr1:30876926..30877082 TTTTTGTGGCAACCTTTGCT Chr1:30877002..30877021 60.65 40
downstream ENSMUSE00000702068 Chr1:30876926..30877082 TTTTTGTGGCAACCTTTGCT Chr1:30877002..30877021 60.65 40
downstream ENSMUSE00000315449 Chr1:30873313..30873429 CTGTTCTCCCTTCGTCTCCA Chr1:30873295..30873314 60.38 55
downstream ENSMUSE00000702067 Chr1:30873313..30873429 CTGTTCTCCCTTCGTCTCCA Chr1:30873295..30873314 60.38 55
downstream ENSMUSE00000476485 Chr1:30870805..30870936 TCGTGATTGGTCGTCTTTCC Chr1:30870860..30870879 61.05 50
downstream ENSMUSE00000551418 Chr1:30870416..30870936 TCCTACCTGGATCTCGATGG Chr1:30870777..30870796 60.03 55
downstream ENSMUSE00000315429 Chr1:30869862..30869997 No primer for this exon
downstream ENSMUSE00000349139 Chr1:30868617..30868812 TTGAAGACAACGCATCTGCT Chr1:30868674..30868693 59.6 45
downstream ENSMUSE00000398107 Chr1:30867528..30867675 GTTCAATCGAGCCAGAAAGG Chr1:30867599..30867618 59.81 50
downstream ENSMUSE00000315573 Chr1:30865568..30865657 TGCCACCTACTTGAATGCTG Chr1:30865605..30865624 59.86 50
downstream ENSMUSE00000315566 Chr1:30863014..30863209 ACACCATAGCGCTTTCTGCT Chr1:30863090..30863109 60.04 50
downstream ENSMUSE00000410830 Chr1:30859187..30862787 CCTCTCTTAGGCCGTGTCTG Chr1:30859804..30859823 60.01 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GATCGAACACATCCTCTTGGA Chr1:30919826..30919847 60.06 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCACCGACTACTCGTGACTG Chr1:30907772..30907792 59.49 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TCTGTTGGGACTCACCATTG Chr1:30908130..30908150 59.52 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TCTGTTGGGACTCACCATTG Chr1:30908130..30908150 59.52 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000048874