Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI5508
Trapped Gene
Msh6 (ENSMUSG00000005370)
Vector Insertion
Chr 17: 88379731 - 88382784
Public Clones YTA071 (baygenomics) W052B01 (ggtc) PST12718-NR (escells)
Private Clones OST440380 (lexicon)
Severity of mutation (?) Insertion after 11% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000138802 (Chr17:88379531..88379730 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000138802 (Chr17:88379531..88379730 +)
Downstram Exon
ENSMUSE00000138805 (Chr17:88382785..88382954 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000515071 Chr17:88374424..88374745 No primer for this exon
upstream ENSMUSE00000138802 Chr17:88379531..88379730 No primer for this exon

*** Putative Vector Insertion (Chr 17: 88379731 - 88382784) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000138805 Chr17:88382785..88382954 No primer for this exon
downstream ENSMUSE00000239692 Chr17:88383786..88386321 No primer for this exon
downstream ENSMUSE00000138797 Chr17:88387526..88387794 No primer for this exon
downstream ENSMUSE00000138804 Chr17:88388484..88388601 No primer for this exon
downstream ENSMUSE00000138806 Chr17:88388767..88388856 No primer for this exon
downstream ENSMUSE00000138795 Chr17:88389534..88389688 No primer for this exon
downstream ENSMUSE00000138793 Chr17:88389771..88389970 No primer for this exon
downstream ENSMUSE00000239566 Chr17:88390064..88390403 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACTCTTCAGCCACCTGGTTC Chr17:88382750..88382770 59.31 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATTTCGTGACTGGGAAAACC Chr17:88382778..88382798 58.89 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000005370