Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI5523
Trapped Gene
Pvr (ENSMUSG00000040511)
Vector Insertion
Chr 7: 20491163 - 20494529
Public Clones YTA133 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 92% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000230052 (Chr7:20494530..20494652 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCGTCTTTGTCCTCGCTGTA Chr7:20494576..20494595 59.59 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000230052 (Chr7:20494530..20494652 -)
Downstram Exon
ENSMUSE00000599092 (Chr7:20491128..20491162 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCGTCTTTGTCCTCGCTGTA Chr7:20494576..20494595 59.59 50 TCTCTGAGGGATTGGACTGC Chr7:20491111..20491130 60.35 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000355337 Chr7:20506302..20506462 GCTGCTGTTCTGCTATGCAC Chr7:20506314..20506333 59.78 55
upstream ENSMUSE00000230075 Chr7:20503911..20504258 TCTCTGGCCATCTCGAACTT Chr7:20504000..20504019 59.95 50
upstream ENSMUSE00000230071 Chr7:20502223..20502519 ACCCTCCTGGACGAATCTCT Chr7:20502413..20502432 60.07 55
upstream ENSMUSE00000230066 Chr7:20500087..20500213 CTCTGGCTATGACGGCAACT Chr7:20500172..20500191 60.42 55
upstream ENSMUSE00000230059 Chr7:20495954..20496105 TTGTGTGCGAAGTCACCAAT Chr7:20495997..20496016 60.16 45
upstream ENSMUSE00000230052 Chr7:20494530..20494652 TCGTCTTTGTCCTCGCTGTA Chr7:20494576..20494595 59.59 50

*** Putative Vector Insertion (Chr 7: 20491163 - 20494529) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000599092 Chr7:20491128..20491162 TCTCTGAGGGATTGGACTGC Chr7:20491111..20491130 60.35 55
downstream ENSMUSE00000599091 Chr7:20489639..20490541 CAGTCTACAGTCGCCGTTCA Chr7:20490481..20490500 60.05 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTCATCATCATCGCAGCACT Chr7:20494554..20494574 59.83 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGTCATCATCATCGCAGCAC Chr7:20494555..20494575 59.83 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040511