Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI5525
Trapped Gene
Cic (ENSMUSG00000005442)
Vector Insertion
Chr 7: 26058653 - 26067197
Public Clones CSA056 (baygenomics) CSA101 (baygenomics) YTA155 (baygenomics) XE565 (baygenomics)
(ggtc) IST14686G4 (tigm) IST11677F10 (tigm) IST13944C11 (tigm) IST11323C10 (tigm)
IST13115B5 (tigm) IST12268B10 (tigm) IST12326F12 (tigm) IST11367A1 (tigm)
IST11875F10 (tigm) IST14984C7 (tigm) IST12798D9BBF1 (tigm) IST14854D5 (tigm)
IST12268B10 (tigm) IST10980H2 (tigm) IST10371A3 (tigm) IST12522E4 (tigm)
IST12994B11 (tigm) IST14984C7 (tigm) IST12593C8 (tigm) IST13036D6 (tigm)
IST13005B10 (tigm) IST14410B12 (tigm) IST14742F12 (tigm) IST15084D5 (tigm)
IST10246G11 (tigm) IST10614H10 (tigm) IST14883F7 (tigm) IST15084C4 (tigm)
IST12443D1 (tigm) IST14346D1 (tigm) IST13016A11 (tigm) IST12837B5 (tigm)
IST11394A4 (tigm) IST11677F10 (tigm) IST10246G11 (tigm) IST12437D6 (tigm)
IST11176H12 (tigm) IST14969F10 (tigm) IST12522E4 (tigm) IST13084G3 (tigm)
IST14686G4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000598322 (Chr7:26055865..26058652 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000598322 (Chr7:26055865..26058652 +)
Downstram Exon
ENSMUSE00000314797 (Chr7:26067198..26067935 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000598322 Chr7:26055865..26058652 No primer for this exon

*** Putative Vector Insertion (Chr 7: 26058653 - 26067197) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000314797 Chr7:26067198..26067935 No primer for this exon
downstream ENSMUSE00000314793 Chr7:26069868..26070017 No primer for this exon
downstream ENSMUSE00000199504 Chr7:26070098..26070332 No primer for this exon
downstream ENSMUSE00000199519 Chr7:26070429..26070558 No primer for this exon
downstream ENSMUSE00000199507 Chr7:26070653..26070835 No primer for this exon
downstream ENSMUSE00000199511 Chr7:26070917..26071082 No primer for this exon
downstream ENSMUSE00000199512 Chr7:26071826..26072028 No primer for this exon
downstream ENSMUSE00000199516 Chr7:26072120..26072345 No primer for this exon
downstream ENSMUSE00000199506 Chr7:26072769..26072872 No primer for this exon
downstream ENSMUSE00000314751 Chr7:26073093..26074320 No primer for this exon
downstream ENSMUSE00000199515 Chr7:26074407..26074594 No primer for this exon
downstream ENSMUSE00000199521 Chr7:26075590..26075711 No primer for this exon
downstream ENSMUSE00000199518 Chr7:26075818..26075984 No primer for this exon
downstream ENSMUSE00000314732 Chr7:26076071..26076361 No primer for this exon
downstream ENSMUSE00000636453 Chr7:26076074..26076361 No primer for this exon
downstream ENSMUSE00000676653 Chr7:26076463..26076788 No primer for this exon
downstream ENSMUSE00000199517 Chr7:26076469..26076788 No primer for this exon
downstream ENSMUSE00000199513 Chr7:26077083..26077333 No primer for this exon
downstream ENSMUSE00000199508 Chr7:26077433..26077587 No primer for this exon
downstream ENSMUSE00000636451 Chr7:26077436..26077587 No primer for this exon
downstream ENSMUSE00000199510 Chr7:26077669..26077800 No primer for this exon
downstream ENSMUSE00000199520 Chr7:26077975..26078106 No primer for this exon
downstream ENSMUSE00000199505 Chr7:26078187..26079161 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCCCCAAGAAGGAAGTCATC Chr7:26064615..26064635 60.82 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCCCCAAGAAGGAAGTCATC Chr7:26064615..26064635 60.82 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000005442