Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI5533
Trapped Gene
Ppp1cc (ENSMUSG00000004455)
Vector Insertion
Chr 5: 122619159 - 122621830
Public Clones YTA150 (baygenomics) M009B04 (ggtc)
Private Clones OST454629 (lexicon) OST339242 (lexicon)
Severity of mutation (?) Insertion after 42% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000516431 (Chr5:122618928..122619158 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000516431 (Chr5:122618928..122619158 +)
Downstram Exon
ENSMUSE00000189075 (Chr5:122621831..122621935 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000706655 Chr5:122608365..122608624 No primer for this exon
upstream ENSMUSE00000189074 Chr5:122618184..122618315 No primer for this exon
upstream ENSMUSE00000516431 Chr5:122618928..122619158 No primer for this exon

*** Putative Vector Insertion (Chr 5: 122619159 - 122621830) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000189075 Chr5:122621831..122621935 No primer for this exon
downstream ENSMUSE00000189069 Chr5:122622741..122622964 No primer for this exon
downstream ENSMUSE00000496953 Chr5:122623155..122623289 No primer for this exon
downstream ENSMUSE00000593285 Chr5:122624064..122624124 No primer for this exon
downstream ENSMUSE00000661838 Chr5:122624064..122625276 No primer for this exon
downstream ENSMUSE00000593284 Chr5:122624989..122625059 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACTTTGCCTCTGAGGAACCA Chr5:122619166..122619186 59.84 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACTTTGCCTCTGAGGAACCA Chr5:122619166..122619186 59.84 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000004455