Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI554
Trapped Gene
Rbm18 (ENSMUSG00000026889)
Vector Insertion
Chr 2: 35982772 - 35989654
Public Clones BC0208 (sanger) RRA138 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 20% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000709954 (Chr2:35989655..35989783 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGACACCGATTATGGATTGG Chr2:35989679..35989698 60.01 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000709954 (Chr2:35989655..35989783 -)
Downstram Exon
ENSMUSE00000163890 (Chr2:35982645..35982771 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGACACCGATTATGGATTGG Chr2:35989679..35989698 60.01 50 GCTTCACCTTGCCAAACTTC Chr2:35982706..35982725 59.86 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000163888 Chr2:35992002..35992131 GGTGTTTCGGCAGAGGTAAC Chr2:35992081..35992100 59.6 55
upstream ENSMUSE00000163894 Chr2:35989655..35989783 GGACACCGATTATGGATTGG Chr2:35989679..35989698 60.01 50
upstream ENSMUSE00000709954 Chr2:35989655..35989783 GGACACCGATTATGGATTGG Chr2:35989679..35989698 60.01 50

*** Putative Vector Insertion (Chr 2: 35982772 - 35989654) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000163890 Chr2:35982645..35982771 GCTTCACCTTGCCAAACTTC Chr2:35982706..35982725 59.86 50
downstream ENSMUSE00000163892 Chr2:35978372..35978458 TTCTTAGACAGCGCCAGCTT Chr2:35978384..35978403 60.29 50
downstream ENSMUSE00000719835 Chr2:35978372..35978458 TTCTTAGACAGCGCCAGCTT Chr2:35978384..35978403 60.29 50
downstream ENSMUSE00000163884 Chr2:35976333..35976418 AAGGCTGATGGGAAGGATCT Chr2:35976352..35976371 60.04 50
downstream ENSMUSE00000716697 Chr2:35976333..35976418 AAGGCTGATGGGAAGGATCT Chr2:35976352..35976371 60.04 50
downstream ENSMUSE00000711940 Chr2:35973146..35973494 TGCTGCTCTGGTAATTCACG Chr2:35973289..35973308 60.01 50
downstream ENSMUSE00000391060 Chr2:35971600..35973494 TGCTGCTCTGGTAATTCACG Chr2:35973289..35973308 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TATGGATTGGCAACCTGGAT Chr2:35986667..35986687 60.15 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTAGGTGCGTGACTGGGAAA Chr2:35983590..35983610 61.22 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026889