Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI5569
Trapped Gene
Brd4 (ENSMUSG00000024002)
Vector Insertion
Chr 17: 32389985 - 32390146
Public Clones RRN086 (baygenomics) YTA250 (baygenomics) P095G08 (ggtc) D042B04 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000311138 (Chr17:32389986..32390145 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTTTCCGTCTGGACACAACA Chr17:32390048..32390067 59.72 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000311138 (Chr17:32389986..32390145 -)
Downstram Exon
ENSMUSE00000711517 (Chr17:32389942..32390145 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTTTCCGTCTGGACACAACA Chr17:32390048..32390067 59.72 50 TGTTGTGTCCAGACGGAAAG Chr17:32390026..32390045 59.72 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000381701 Chr17:32421008..32421054 AAGCGACTGCCTCTGGATCT Chr17:32421027..32421046 61.47 55
upstream ENSMUSE00000709740 Chr17:32421008..32421042 No primer for this exon
upstream ENSMUSE00000311138 Chr17:32389986..32390145 CTTTCCGTCTGGACACAACA Chr17:32390048..32390067 59.72 50

*** Putative Vector Insertion (Chr 17: 32389985 - 32390146) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000711517 Chr17:32389942..32390145 TGTTGTGTCCAGACGGAAAG Chr17:32390026..32390045 59.72 50
downstream ENSMUSE00000311117 Chr17:32366362..32366680 GGCCTGCGTTGTAGACATTT Chr17:32366532..32366551 60.14 50
downstream ENSMUSE00000714803 Chr17:32366362..32366680 GGCCTGCGTTGTAGACATTT Chr17:32366532..32366551 60.14 50
downstream ENSMUSE00000547604 Chr17:32362521..32362658 TTGTTTTCCAAGCGCTTCTT Chr17:32362572..32362591 60 40
downstream ENSMUSE00000699480 Chr17:32361032..32361167 TTTCTTTCCTCCCTCGTCCT Chr17:32361013..32361032 60.18 50
downstream ENSMUSE00000137065 Chr17:32361029..32361167 TTTCTTTCCTCCCTCGTCCT Chr17:32361013..32361032 60.18 50
downstream ENSMUSE00000137074 Chr17:32358818..32359110 TTGGTACCGTGGATACACCA Chr17:32359056..32359075 59.69 50
downstream ENSMUSE00000137093 Chr17:32358091..32358453 TCCGGTACATCCTTCTTTGG Chr17:32358271..32358290 59.93 50
downstream ENSMUSE00000137069 Chr17:32357106..32357234 ACATCAATCGGACATCAGCA Chr17:32357149..32357168 60.08 45
downstream ENSMUSE00000137090 Chr17:32351576..32351785 TCAGTGGAACTGTCGCTGTC Chr17:32351603..32351622 60.03 55
downstream ENSMUSE00000310929 Chr17:32350472..32350671 CTCACATTGCTGTTGCTGCT Chr17:32350450..32350469 60.21 50
downstream ENSMUSE00000137079 Chr17:32349784..32350079 TCGTGGGTACTGGTTCCTTC Chr17:32350035..32350054 59.97 55
downstream ENSMUSE00000547571 Chr17:32348112..32348222 AGAACCAGCAATCACGTCAA Chr17:32348172..32348191 59.29 45
downstream ENSMUSE00000699479 Chr17:32343614..32343938 TATAGCTCGCTGGGAAGGAA Chr17:32343843..32343862 59.94 50
downstream ENSMUSE00000713464 Chr17:32341855..32343940 CCGGGAACAGAAAACTACCA Chr17:32342105..32342124 59.96 50
downstream ENSMUSE00000137081 Chr17:32339613..32339665 TTTTGACTTGGGAGCCATCT Chr17:32339624..32339643 59.67 45
downstream ENSMUSE00000137082 Chr17:32339119..32339491 GAAGTGGCCAATAGGGTCAA Chr17:32339209..32339228 59.93 50
downstream ENSMUSE00000137070 Chr17:32337947..32338537 CACCTTCACGGAAGGGAGTA Chr17:32338247..32338266 60.1 55
downstream ENSMUSE00000310779 Chr17:32335841..32336215 CTGCGAATGATTGGTGAGTG Chr17:32335899..32335918 60.26 50
downstream ENSMUSE00000137091 Chr17:32335628..32335758 TTTTTGGCTCCTGCTTCTGT Chr17:32335626..32335645 59.99 45
downstream ENSMUSE00000137087 Chr17:32335302..32335507 ACTTGAGGACTTGGCTGTGG Chr17:32335399..32335418 60.3 55
downstream ENSMUSE00000137078 Chr17:32334976..32335219 CTGCTGCTGCTCCTGTCTCT Chr17:32335086..32335105 61.05 60
downstream ENSMUSE00000423965 Chr17:32333221..32334765 CAGTCACCCCTGTCCAAACT Chr17:32334015..32334034 60 55
downstream ENSMUSE00000711346 Chr17:32333219..32334765 CAGTCACCCCTGTCCAAACT Chr17:32334015..32334034 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGTCATTCTGCCCCTCTTCT Chr17:32390162..32390182 59.8 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGTCATTCTGCCCCTCTTCT Chr17:32390162..32390182 59.8 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024002