Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI5570
Trapped Gene
Wapal (ENSMUSG00000041408)
Vector Insertion
Chr 14: 35490139 - 35490661
Public Clones YTA258 (baygenomics) XC324 (baygenomics) TEA135 (baygenomics) RRC078 (baygenomics)
A060F03 (ggtc) A060E04 (ggtc)
Private Clones OST134571 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000710176 (Chr14:35490140..35490660 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGGAGATCCCTTTGGTTTTG Chr14:35490368..35490387 59.9 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000710176 (Chr14:35490140..35490660 +)
Downstram Exon
ENSMUSE00000617960 (Chr14:35490140..35490660 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGGAGATCCCTTTGGTTTTG Chr14:35490368..35490387 59.9 45 CAAAACCAAAGGGATCTCCA Chr14:35490390..35490409 59.9 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000412292 Chr14:35487114..35487546 GCCCGAGCTTCCTATTTACC Chr14:35487364..35487383 60.06 55
upstream ENSMUSE00000689495 Chr14:35487150..35487247 AACTCCAGCGCTGACCATTC Chr14:35487179..35487198 62.68 55
upstream ENSMUSE00000561564 Chr14:35487528..35487546 No primer for this exon

*** Putative Vector Insertion (Chr 14: 35490139 - 35490661) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000617960 Chr14:35490140..35490660 CAAAACCAAAGGGATCTCCA Chr14:35490390..35490409 59.9 45
downstream ENSMUSE00000710176 Chr14:35490140..35490660 CAAAACCAAAGGGATCTCCA Chr14:35490390..35490409 59.9 45
downstream ENSMUSE00000330579 Chr14:35504868..35505920 CGAAAACTGGTCCCACAACT Chr14:35505441..35505460 60.01 50
downstream ENSMUSE00000689491 Chr14:35507523..35507632 AGTCTTGCCTTGGCTCACTC Chr14:35507630..35507649 59.6 55
downstream ENSMUSE00000330568 Chr14:35508173..35508291 TTCACACTCTCAGGCACACC Chr14:35508224..35508243 59.87 55
downstream ENSMUSE00000689490 Chr14:35508173..35508291 TTCACACTCTCAGGCACACC Chr14:35508224..35508243 59.87 55
downstream ENSMUSE00000689494 Chr14:35508191..35508291 TTCACACTCTCAGGCACACC Chr14:35508224..35508243 59.87 55
downstream ENSMUSE00000330560 Chr14:35535450..35535545 TTCTTCCGAGTCTGGATGGT Chr14:35535509..35535528 59.65 50
downstream ENSMUSE00000689489 Chr14:35535450..35535545 TTCTTCCGAGTCTGGATGGT Chr14:35535509..35535528 59.65 50
downstream ENSMUSE00000330550 Chr14:35537892..35538044 CACTTTGAGTGGTGGTGCAG Chr14:35537969..35537988 60.35 55
downstream ENSMUSE00000689488 Chr14:35537892..35538044 CACTTTGAGTGGTGGTGCAG Chr14:35537969..35537988 60.35 55
downstream ENSMUSE00000330539 Chr14:35538314..35538450 TGAAGTGTTTCACGTGCTGA Chr14:35538350..35538369 59 45
downstream ENSMUSE00000689487 Chr14:35538314..35538450 TGAAGTGTTTCACGTGCTGA Chr14:35538350..35538369 59 45
downstream ENSMUSE00000330530 Chr14:35539086..35539197 TGCTGGGAATCATCCAAAGT Chr14:35539193..35539212 60.46 45
downstream ENSMUSE00000689486 Chr14:35539086..35539197 TGCTGGGAATCATCCAAAGT Chr14:35539193..35539212 60.46 45
downstream ENSMUSE00000330520 Chr14:35542366..35542593 TCTAGGCTGGCCCTATCAAG Chr14:35542451..35542470 59.43 55
downstream ENSMUSE00000330508 Chr14:35543735..35543846 AATCTCCTGCTCGTTTGGAA Chr14:35543795..35543814 59.81 45
downstream ENSMUSE00000330494 Chr14:35544695..35544795 TGCTCCCCATAATGAGGCTA Chr14:35544771..35544790 60.56 50
downstream ENSMUSE00000330481 Chr14:35546917..35546993 No primer for this exon
downstream ENSMUSE00000330469 Chr14:35549856..35550031 TCTCAGCACGGTTGTACTGC Chr14:35549908..35549927 60.06 55
downstream ENSMUSE00000330458 Chr14:35550457..35550572 TTCATCGCTGTGCCTATGAG Chr14:35550514..35550533 59.97 50
downstream ENSMUSE00000330450 Chr14:35551042..35551206 TGACAAGGCAGTGTCGATTC Chr14:35551105..35551124 59.84 50
downstream ENSMUSE00000330441 Chr14:35552417..35552624 CATGCTGAGTGGTAGGAGCA Chr14:35552504..35552523 60.01 55
downstream ENSMUSE00000330435 Chr14:35554243..35554331 GCTACGATGCAATCCTCCAT Chr14:35554288..35554307 60.07 50
downstream ENSMUSE00000330430 Chr14:35557995..35558090 No primer for this exon
downstream ENSMUSE00000394258 Chr14:35558811..35559403 TCAGCATTACCAAGCACCTG Chr14:35558916..35558935 59.86 50
downstream ENSMUSE00000561561 Chr14:35558811..35559043 ACGCAGAATGCATGATGAAG Chr14:35559043..35559062 59.83 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTACTAATCGCCTTGCAGCAC Chr14:35490186..35490207 60.41 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTACCGTGACTGGGAAAACC Chr14:35490186..35490206 59.83 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000041408