Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI5579
Trapped Gene
Dcun1d5 (ENSMUSG00000032002)
Vector Insertion
Chr 9: 7186860 - 7188745
Public Clones YTA261 (baygenomics) RRU084 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 25% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000215712 (Chr9:7186768..7186859 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGAAAGAAGTGCCTGGCTTG Chr9:7186823..7186842 59.62 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000215712 (Chr9:7186768..7186859 +)
Downstram Exon
ENSMUSE00000215711 (Chr9:7188746..7188816 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGAAAGAAGTGCCTGGCTTG Chr9:7186823..7186842 59.62 50 GGCCCTACAACTTCATCAGG Chr9:7188770..7188789 59.55 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000341261 Chr9:7184549..7184882 AGAGAAAAGCTCCCGGAGTG Chr9:7184813..7184832 60.89 55
upstream ENSMUSE00000215712 Chr9:7186768..7186859 AGAAAGAAGTGCCTGGCTTG Chr9:7186823..7186842 59.62 50

*** Putative Vector Insertion (Chr 9: 7186860 - 7188745) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000215711 Chr9:7188746..7188816 GGCCCTACAACTTCATCAGG Chr9:7188770..7188789 59.55 55
downstream ENSMUSE00000303127 Chr9:7189162..7189253 AGCCTCCAATTTCCATGCTA Chr9:7189200..7189219 59.67 45
downstream ENSMUSE00000303101 Chr9:7203263..7203371 AGCTGAGAGCGCAGAAAATC Chr9:7203319..7203338 59.87 50
downstream ENSMUSE00000303078 Chr9:7203451..7203555 ATGTTCTCCCAAGCAGCAGA Chr9:7203523..7203542 60.94 50
downstream ENSMUSE00000539951 Chr9:7205298..7205400 No primer for this exon
downstream ENSMUSE00000638698 Chr9:7206720..7207031 GGTTTGCATTGTCTTCACGA Chr9:7206807..7206826 59.7 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTGCCTGGCTTGGTTTTATG Chr9:7186832..7186852 60.5 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTGCCTGGCTTGGTTTTATG Chr9:7186832..7186852 60.5 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032002