Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI5591
Trapped Gene
Rrp12 (ENSMUSG00000035049)
Vector Insertion
Chr 19: 41969868 - 41970428
Public Clones XH708 (baygenomics) YTA296 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 4% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000278925 (Chr19:41970429..41970663 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTTGAAGCGCTGGAAGAAAG Chr19:41970507..41970526 60.13 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000278925 (Chr19:41970429..41970663 -)
Downstram Exon
ENSMUSE00000279737 (Chr19:41969638..41969867 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTTGAAGCGCTGGAAGAAAG Chr19:41970507..41970526 60.13 50 CGAGGACTTCTCGGTGAAAG Chr19:41969709..41969728 59.98 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000278925 Chr19:41970429..41970663 GTTGAAGCGCTGGAAGAAAG Chr19:41970507..41970526 60.13 50

*** Putative Vector Insertion (Chr 19: 41969868 - 41970428) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000279737 Chr19:41969638..41969867 CGAGGACTTCTCGGTGAAAG Chr19:41969709..41969728 59.98 55
downstream ENSMUSE00000279714 Chr19:41967028..41967111 TGGGATCGAATCACCTCTGT Chr19:41967046..41967065 60.47 50
downstream ENSMUSE00000279689 Chr19:41965574..41965650 GGACTCCACTGCTTCCATTG Chr19:41965602..41965621 60.66 55
downstream ENSMUSE00000279669 Chr19:41964559..41964664 TGATGTCCATGAAGGCTTTG Chr19:41964581..41964600 59.65 45
downstream ENSMUSE00000279649 Chr19:41964256..41964372 GGTGAAGCTCAGCAGTCCAT Chr19:41964252..41964271 60.42 55
downstream ENSMUSE00000279638 Chr19:41961501..41961639 CATGAAGTCACTGCCCTTGA Chr19:41961561..41961580 59.83 50
downstream ENSMUSE00000279622 Chr19:41961290..41961417 GACCCGAAGCAGAGTCTCAC Chr19:41961286..41961305 59.99 60
downstream ENSMUSE00000279597 Chr19:41960577..41960675 CGTTGAGTTCTGCTGACAGG Chr19:41960569..41960588 59.62 55
downstream ENSMUSE00000279565 Chr19:41960137..41960228 CAGCAGGGGCTGTAAATCAT Chr19:41960159..41960178 60.1 50
downstream ENSMUSE00000279530 Chr19:41958203..41958314 GTTCCGAAAAATCGAGCAAG Chr19:41958245..41958264 59.82 45
downstream ENSMUSE00000279484 Chr19:41957913..41958010 TGTACTGGGGAGGACCTGAG Chr19:41957907..41957926 60.1 60
downstream ENSMUSE00000279456 Chr19:41956649..41956763 GTATGTGAGGCCCTCTTCCA Chr19:41956717..41956736 60.07 55
downstream ENSMUSE00000279432 Chr19:41954849..41954991 CAGAGCCATCGATTTCCAAG Chr19:41954828..41954847 60.73 50
downstream ENSMUSE00000279407 Chr19:41954592..41954713 AACATGATCCCGGATGACAG Chr19:41954637..41954656 60.75 50
downstream ENSMUSE00000279386 Chr19:41952519..41952583 TCTTCGACTCCACTGTGCTG Chr19:41952520..41952539 60.18 55
downstream ENSMUSE00000279351 Chr19:41952274..41952436 GATAGCTGTGCCCAGAGTCC Chr19:41952325..41952344 59.83 60
downstream ENSMUSE00000279317 Chr19:41951826..41951980 TTTGATGGTTTCCAGCACAG Chr19:41951831..41951850 59.69 45
downstream ENSMUSE00000279301 Chr19:41951591..41951658 AGAACCTTCTCGGTGGCTTT Chr19:41951596..41951615 60.25 50
downstream ENSMUSE00000279281 Chr19:41951025..41951118 GCAGCTTCATCCGAGTAAGG Chr19:41951043..41951062 59.98 55
downstream ENSMUSE00000279260 Chr19:41949207..41949365 TGAGAACTGGCACACACCTC Chr19:41949279..41949298 59.87 55
downstream ENSMUSE00000279236 Chr19:41949019..41949099 CCGACAGCGTCTTCACAATA Chr19:41949035..41949054 59.86 50
downstream ENSMUSE00000279214 Chr19:41948726..41948831 ACCAGCAAGGTAAACGCACT Chr19:41948748..41948767 59.8 50
downstream ENSMUSE00000279198 Chr19:41948233..41948340 AGAGCCAAAATGCTGCAACT Chr19:41948237..41948256 60.02 45
downstream ENSMUSE00000279181 Chr19:41947399..41947556 CTTGACCACATCACGGGTTC Chr19:41947452..41947471 61.38 55
downstream ENSMUSE00000279163 Chr19:41946223..41946314 AACTTGCGGGTGAACTTGAT Chr19:41946204..41946223 59.6 45
downstream ENSMUSE00000279132 Chr19:41945912..41946079 TATTCTGCGGGTAGCAGACC Chr19:41946022..41946041 60.24 55
downstream ENSMUSE00000279093 Chr19:41945625..41945794 TTGGGATCCAGGAAGTTGAG Chr19:41945623..41945642 60.04 50
downstream ENSMUSE00000279069 Chr19:41945300..41945425 AAGCCATGGTCCCTCTTCTT Chr19:41945358..41945377 60.07 50
downstream ENSMUSE00000279051 Chr19:41943260..41943309 GCATCGGTCATGTCTTCATC Chr19:41943263..41943282 59.04 50
downstream ENSMUSE00000279030 Chr19:41941196..41941262 TCTGCCGCTTAAGCTTCTTT Chr19:41941219..41941238 59.38 45
downstream ENSMUSE00000279008 Chr19:41940011..41940078 GGCCTTGTATTCAGCTCCAG Chr19:41939992..41940011 59.84 55
downstream ENSMUSE00000278981 Chr19:41939662..41939744 AGTGGAACGTACGCATAGGG Chr19:41939664..41939683 60.01 55
downstream ENSMUSE00000278959 Chr19:41937346..41937802 CTGGACCACAGCAGAGAACA Chr19:41937635..41937654 60.02 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTGGCATTCGGCCTGTAATC Chr19:41970372..41970392 62.69 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000035049