Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI5621
Trapped Gene
Ptbp2 (ENSMUSG00000028134)
Vector Insertion
Chr 3: 119456035 - 119464620
Public Clones YHB091 (baygenomics) XE422 (baygenomics) CSI803 (baygenomics) XE704 (baygenomics)
A068D07 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 7% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000176640 (Chr3:119464621..119464696 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTCAGCAGCCCCAACTCTAA Chr3:119464644..119464663 60.53 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000176640 (Chr3:119464621..119464696 -)
Downstram Exon
ENSMUSE00000176627 (Chr3:119455862..119456034 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTCAGCAGCCCCAACTCTAA Chr3:119464644..119464663 60.53 55 GGAGCCCCATCCATTTTATC Chr3:119455958..119455977 60.48 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000670024 Chr3:119486120..119486176 No primer for this exon
upstream ENSMUSE00000267487 Chr3:119484422..119484452 GTCACTGAGGTTGCTGTTGG Chr3:119484429..119484448 59.31 55
upstream ENSMUSE00000176640 Chr3:119464621..119464696 CTCAGCAGCCCCAACTCTAA Chr3:119464644..119464663 60.53 55

*** Putative Vector Insertion (Chr 3: 119456035 - 119464620) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000176627 Chr3:119455862..119456034 GGAGCCCCATCCATTTTATC Chr3:119455958..119455977 60.48 50
downstream ENSMUSE00000176622 Chr3:119454782..119454925 GTTGCCAGTTCCAAAAATGC Chr3:119454884..119454903 60.49 45
downstream ENSMUSE00000176631 Chr3:119450708..119450872 GAGTCACCGCACTCTCACTG Chr3:119450760..119450779 59.6 60
downstream ENSMUSE00000176638 Chr3:119450510..119450620 GCGTTTACCGGATCACCATA Chr3:119450504..119450523 60.72 50
downstream ENSMUSE00000176624 Chr3:119443233..119443428 CTCCAGATGGCAGATCAGGT Chr3:119443274..119443293 60.22 55
downstream ENSMUSE00000176636 Chr3:119428984..119429123 TGTATTGCCACCAGCTGAGA Chr3:119428992..119429011 60.41 50
downstream ENSMUSE00000176642 Chr3:119427530..119427563 AGACTTTGGGGCGTAACCAT Chr3:119427522..119427541 60.74 50
downstream ENSMUSE00000176634 Chr3:119427012..119427104 CGCTGCACATCTCCATAAAC Chr3:119427061..119427080 59.3 50
downstream ENSMUSE00000176632 Chr3:119423707..119423923 TTAAAACGGTGCAGTGGTGA Chr3:119423754..119423773 60.15 45
downstream ENSMUSE00000176644 Chr3:119423525..119423602 GGCAAACAGAGTTCGCAGAT Chr3:119423541..119423560 60.41 50
downstream ENSMUSE00000636243 Chr3:119421918..119423378 ACGATGTGCCCTAAACAACC Chr3:119422895..119422914 59.86 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTATAATCGCCTTGCAGCAC Chr3:119461552..119461572 58.56 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAAACACAGACTGAGGCACA Chr3:119461592..119461612 58.4 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028134