Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI5624
Trapped Gene
Trim17 (ENSMUSG00000036964)
Vector Insertion
Chr 11: 58768895 - 58777282
Public Clones CSI796 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000453635 (Chr11:58768187..58768894 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCAAAAGCGAAGTCTCGTTC Chr11:58768276..58768295 60.14 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000453635 (Chr11:58768187..58768894 +)
Downstram Exon
ENSMUSE00000453611 (Chr11:58777283..58777371 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCAAAAGCGAAGTCTCGTTC Chr11:58768276..58768295 60.14 50 AGGCTGGGTTTGTGCTACAG Chr11:58777317..58777336 60.31 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000453635 Chr11:58768187..58768894 GCAAAAGCGAAGTCTCGTTC Chr11:58768276..58768295 60.14 50

*** Putative Vector Insertion (Chr 11: 58768895 - 58777282) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000453611 Chr11:58777283..58777371 AGGCTGGGTTTGTGCTACAG Chr11:58777317..58777336 60.31 55
downstream ENSMUSE00000678128 Chr11:58778616..58779049 TTAAGGGGTTCTTGGTGTGC Chr11:58778943..58778962 59.97 50
downstream ENSMUSE00000717001 Chr11:58778616..58779049 TTAAGGGGTTCTTGGTGTGC Chr11:58778943..58778962 59.97 50
downstream ENSMUSE00000590370 Chr11:58780276..58780371 GCTTGCAGTGTCTCCGTCTT Chr11:58780343..58780362 60.6 55
downstream ENSMUSE00000590369 Chr11:58781989..58782219 GGATCCTCCGTTCTTCTTCC Chr11:58782076..58782095 60.01 55
downstream ENSMUSE00000590368 Chr11:58783929..58783951 No primer for this exon
downstream ENSMUSE00000302826 Chr11:58784044..58784147 TTGGAAGCTTTTGAGCACCT Chr11:58784149..58784168 59.99 45
downstream ENSMUSE00000590372 Chr11:58784048..58784147 TTGGAAGCTTTTGAGCACCT Chr11:58784149..58784168 59.99 45
downstream ENSMUSE00000479850 Chr11:58784529..58785231 GCACTCTGTCCTTCCGACTC Chr11:58784789..58784808 59.99 60
downstream ENSMUSE00000499502 Chr11:58784529..58786600 CTGTCCGGAATGGACAAACT Chr11:58786311..58786330 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAAAAATCATAATCGCCTTGC Chr11:58774937..58774958 59.58 38.1 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGCAGTTAACGTTCGTGTTTG Chr11:58774898..58774919 59.82 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000036964