Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI5647
Trapped Gene
Myst2 (ENSMUSG00000038909)
Vector Insertion
Chr 11: 95161533 - 95164446
Public Clones (sanger) CSI647 (baygenomics) CSI738 (baygenomics) CSH200 (baygenomics)
CSI646 (baygenomics) HMA367 (baygenomics) W031F03 (ggtc) PST11307-NR (escells)
Private Clones not available
Severity of mutation (?) Insertion after 19% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000577649 (Chr11:95164447..95164623 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAAGGGTGACCCGTAGTCAG Chr11:95164544..95164563 59.57 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000577649 (Chr11:95164447..95164623 -)
Downstram Exon
ENSMUSE00000648581 (Chr11:95161293..95161532 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAAGGGTGACCCGTAGTCAG Chr11:95164544..95164563 59.57 60 GGAGTTCGAGGTGGTGACTC Chr11:95161465..95161484 59.69 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000661432 Chr11:95171349..95171515 AGGGTTTGGGACAGCTACAG Chr11:95171450..95171469 59.21 55
upstream ENSMUSE00000674260 Chr11:95170851..95170916 CGGATAGAGATGGCGATAGG Chr11:95170861..95170880 59.65 55
upstream ENSMUSE00000674263 Chr11:95170851..95170871 No primer for this exon
upstream ENSMUSE00000445467 Chr11:95167363..95167510 GGAACCGAAGATTCCGATTT Chr11:95167467..95167486 60.26 45
upstream ENSMUSE00000577649 Chr11:95164447..95164623 GAAGGGTGACCCGTAGTCAG Chr11:95164544..95164563 59.57 60

*** Putative Vector Insertion (Chr 11: 95161533 - 95164446) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000648581 Chr11:95161293..95161532 GGAGTTCGAGGTGGTGACTC Chr11:95161465..95161484 59.69 60
downstream ENSMUSE00000648580 Chr11:95155877..95155959 TATGATACAGCGGGCATCCT Chr11:95155878..95155897 60.46 50
downstream ENSMUSE00000577648 Chr11:95152834..95152923 GTTGCATGCCTGTTGTTGTC Chr11:95152822..95152841 60.17 50
downstream ENSMUSE00000648578 Chr11:95151086..95151184 ACCGCAGCTGTCTCTCTGTT Chr11:95151138..95151157 60.21 55
downstream ENSMUSE00000648577 Chr11:95147644..95147754 AGAGAGGCTCCCGAGTGTTC Chr11:95147693..95147712 60.93 60
downstream ENSMUSE00000648576 Chr11:95145343..95145534 GATTTGGCCTTGAAGCCTTA Chr11:95145486..95145505 59.3 45
downstream ENSMUSE00000648574 Chr11:95143153..95143242 GATGGAGCCTTTGCGATAAA Chr11:95143164..95143183 60.17 45
downstream ENSMUSE00000648573 Chr11:95142815..95142955 CAGCCAGTATTGTCCGCTTC Chr11:95142818..95142837 60.8 55
downstream ENSMUSE00000648572 Chr11:95141705..95141798 GATCAGCATCTTCCCGTAGC Chr11:95141690..95141709 59.8 55
downstream ENSMUSE00000648571 Chr11:95138783..95138929 TGGAGAGCCGACTTTCTCTT Chr11:95138867..95138886 59.16 50
downstream ENSMUSE00000648570 Chr11:95137757..95137863 ACGGGATTCACAGCTGTTTC Chr11:95137811..95137830 60.12 50
downstream ENSMUSE00000648569 Chr11:95135574..95137201 CTTGCCAATCACAAGAGCAA Chr11:95136984..95137003 59.99 45
downstream ENSMUSE00000413313 Chr11:95135573..95137201 CTTGCCAATCACAAGAGCAA Chr11:95136984..95137003 59.99 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTCTGTGGGACTGGCTCTGT Chr11:95164417..95164437 60.31 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTCTGTGGGACTGGCTCTGT Chr11:95164417..95164437 60.31 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CAAAGCCCACCAACTCTTCT Chr11:95161594..95161614 59.33 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CAAAGCCCACCAACTCTTCT Chr11:95161594..95161614 59.33 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038909