Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI5666
Trapped Gene
Ckap5 (ENSMUSG00000040549)
Vector Insertion
Chr 2: 91426074 - 91426394
Public Clones CSI617 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 52% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000449729 (Chr2:91425879..91426073 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCTACACTCCGTTCCACTCC Chr2:91425906..91425925 59.57 60 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000449729 (Chr2:91425879..91426073 +)
Downstram Exon
ENSMUSE00000449724 (Chr2:91426395..91426530 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCTACACTCCGTTCCACTCC Chr2:91425906..91425925 59.57 60 TTTGGCCTTTTCTAGCATGG Chr2:91426442..91426461 60.2 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000643315 Chr2:91366994..91367007 No primer for this exon
upstream ENSMUSE00000643314 Chr2:91386479..91386572 TGGGAGATGACAGTGAGTGG Chr2:91386517..91386536 59.66 55
upstream ENSMUSE00000399736 Chr2:91386490..91386572 TGGGAGATGACAGTGAGTGG Chr2:91386517..91386536 59.66 55
upstream ENSMUSE00000167374 Chr2:91388931..91389124 AATGCTCATGTTGCAGGAAA Chr2:91389105..91389124 59.28 40
upstream ENSMUSE00000390637 Chr2:91390709..91390915 CTGAAGGGCCTGGATAACAA Chr2:91390845..91390864 60.07 50
upstream ENSMUSE00000352788 Chr2:91395424..91395595 TGGAATCGAGATGCTGTGAA Chr2:91395545..91395564 60.35 45
upstream ENSMUSE00000167375 Chr2:91396657..91396789 CTAAGCCCAGTCGGTTTCTG Chr2:91396703..91396722 59.87 55
upstream ENSMUSE00000167380 Chr2:91397732..91397832 TGGATGCGGTAGAGATCCTT Chr2:91397780..91397799 59.65 50
upstream ENSMUSE00000371865 Chr2:91399206..91399319 GAAAAACCCCAAGCTGGAAG Chr2:91399262..91399281 60.96 50
upstream ENSMUSE00000519590 Chr2:91400964..91401068 TGTTGGAAAGGACACCAATG Chr2:91400966..91400985 59.39 45
upstream ENSMUSE00000687485 Chr2:91402911..91403000 No primer for this exon
upstream ENSMUSE00000167373 Chr2:91403106..91403270 TTGCAAGAAGCTTTCGTCAC Chr2:91403191..91403210 59.2 45
upstream ENSMUSE00000167378 Chr2:91404477..91404605 CAGCTTTGAAGGTGGTTGGT Chr2:91404532..91404551 60.15 50
upstream ENSMUSE00000167392 Chr2:91405778..91405960 CCAAACCAGGACCGTTAAAA Chr2:91405923..91405942 59.83 45
upstream ENSMUSE00000167369 Chr2:91408294..91408407 GTGCCGGGACAAAGAATAAG Chr2:91408346..91408365 59.57 50
upstream ENSMUSE00000167382 Chr2:91408794..91408904 GCTGGCCTGTATGGAAGAAT Chr2:91408877..91408896 59.15 50
upstream ENSMUSE00000167390 Chr2:91410337..91410429 AATGGAGCGAACTGAGATGC Chr2:91410348..91410367 60.37 50
upstream ENSMUSE00000167371 Chr2:91412505..91412690 TGTGGGAACAATGCAAAAGA Chr2:91412619..91412638 60.09 40
upstream ENSMUSE00000449769 Chr2:91413130..91413224 GTCAATGGCCTTCTCACAAAA Chr2:91413135..91413155 60.1 42.86
upstream ENSMUSE00000449762 Chr2:91416173..91416230 CGTGAAGACTGCTCTTGCTG Chr2:91416200..91416219 59.92 55
upstream ENSMUSE00000449758 Chr2:91416320..91416445 CTGCTTGGCGTGATGTATCT Chr2:91416344..91416363 58.9 50
upstream ENSMUSE00000449749 Chr2:91417721..91417860 GATCTTTTGCCGAGGATTGA Chr2:91417835..91417854 60.15 45
upstream ENSMUSE00000449746 Chr2:91418192..91418366 TTGAAGGGTCGACTGAATGA Chr2:91418331..91418350 59.22 45
upstream ENSMUSE00000449741 Chr2:91419580..91419693 TGTAAAGAACCTGGGCATCC Chr2:91419645..91419664 59.93 50
upstream ENSMUSE00000449733 Chr2:91421267..91421395 AATGCTTGGGCAGAACAAAC Chr2:91421300..91421319 60.12 45
upstream ENSMUSE00000449729 Chr2:91425879..91426073 CCTACACTCCGTTCCACTCC Chr2:91425906..91425925 59.57 60

*** Putative Vector Insertion (Chr 2: 91426074 - 91426394) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000449724 Chr2:91426395..91426530 TTTGGCCTTTTCTAGCATGG Chr2:91426442..91426461 60.2 45
downstream ENSMUSE00000449280 Chr2:91428826..91428914 AAGAAACGCCTGGAGCTTTA Chr2:91428906..91428925 59.11 45
downstream ENSMUSE00000449277 Chr2:91431823..91431948 TTTGCTTGGCACTTTCTTCC Chr2:91431855..91431874 60.37 45
downstream ENSMUSE00000385033 Chr2:91434840..91434989 TCATCCCGTGGGGTAGTAAA Chr2:91434877..91434896 60.18 50
downstream ENSMUSE00000301737 Chr2:91435468..91435671 AGGGGATAAAGGACGATGCT Chr2:91435660..91435679 59.92 50
downstream ENSMUSE00000301727 Chr2:91435845..91435980 CACATCCGGTTCAGGATAGC Chr2:91435906..91435925 60.48 55
downstream ENSMUSE00000301721 Chr2:91436519..91436712 TTCCGTACAGCATTGTCTCG Chr2:91436645..91436664 59.86 50
downstream ENSMUSE00000301714 Chr2:91439363..91439535 TGCTGACCGCTTTATCCTCT Chr2:91439416..91439435 59.98 50
downstream ENSMUSE00000301705 Chr2:91440798..91440971 TTTCACAGCGGACTGTACCA Chr2:91440910..91440929 60.3 50
downstream ENSMUSE00000301700 Chr2:91441163..91441283 TCAGAGCTTGGATGCTTGTG Chr2:91441281..91441300 60.14 50
downstream ENSMUSE00000301692 Chr2:91446403..91446582 TGATCAATGTGGCCAGACAT Chr2:91446464..91446483 59.92 45
downstream ENSMUSE00000391433 Chr2:91447602..91447789 TCACCACCAAGAGGTTCACA Chr2:91447755..91447774 60.13 50
downstream ENSMUSE00000301675 Chr2:91452897..91452972 AGCTGTTGCTAGCAGGCTGT Chr2:91452942..91452961 60.36 55
downstream ENSMUSE00000362729 Chr2:91455130..91455318 TGCTGTTGATGGTGTCAGGT Chr2:91455178..91455197 60.16 50
downstream ENSMUSE00000301668 Chr2:91455399..91455536 ATGCTTCATCATCCGACACA Chr2:91455479..91455498 60.08 45
downstream ENSMUSE00000301660 Chr2:91455951..91456034 TGGCCTTTGATGATTTTTCA Chr2:91455975..91455994 59.09 35
downstream ENSMUSE00000380899 Chr2:91456458..91456617 GCCTTTGCTTTCTCTCTCCA Chr2:91456601..91456620 59.69 50
downstream ENSMUSE00000687475 Chr2:91459845..91459996 GCACACATGTGACCTCCATC Chr2:91459880..91459899 59.97 55
downstream ENSMUSE00000336116 Chr2:91459908..91459996 GTAGACAGATGGCCCCACTT Chr2:91459948..91459967 59.02 55
downstream ENSMUSE00000373938 Chr2:91460139..91460819 CAACTGGAGGAATTGCTGGT Chr2:91460199..91460218 60.11 50
downstream ENSMUSE00000687474 Chr2:91460139..91460820 CAACTGGAGGAATTGCTGGT Chr2:91460199..91460218 60.11 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr2:91426124..91426144 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATGGCTAAGGCTACTGGGAAA Chr2:91426048..91426069 60.1 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040549