Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI5670
Trapped Gene
Ndufaf2 (ENSMUSG00000068184)
Vector Insertion
Chr 13: 108881818 - 108948636
Public Clones (sanger) (sanger) CSI636 (baygenomics) Ayu21-T533 (egtc) IST15003F3 (tigm)
IST13599A10 (tigm) IST13494B9 (tigm) IST13031B5 (tigm)
Private Clones OST436064 (lexicon) OST357276 (lexicon) OST280364 (lexicon) OST61113 (lexicon)
Severity of mutation (?) Insertion after 25% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000375362 (Chr13:108948637..108948785 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACGTCGCCGAGTACAAGAAC Chr13:108948644..108948663 60.32 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000375362 (Chr13:108948637..108948785 -)
Downstram Exon
ENSMUSE00000317502 (Chr13:108881728..108881817 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACGTCGCCGAGTACAAGAAC Chr13:108948644..108948663 60.32 55 TGGGATGTCTCCTGCTTCAT Chr13:108881719..108881738 60.62 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000375362 Chr13:108948637..108948785 ACGTCGCCGAGTACAAGAAC Chr13:108948644..108948663 60.32 55

*** Putative Vector Insertion (Chr 13: 108881818 - 108948636) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000317502 Chr13:108881728..108881817 TGGGATGTCTCCTGCTTCAT Chr13:108881719..108881738 60.62 50
downstream ENSMUSE00000120093 Chr13:108871547..108871587 GTGGGTGGAGTCTTCCTTGT Chr13:108871532..108871551 59 55
downstream ENSMUSE00000348397 Chr13:108842897..108843148 AGAGGCGTGCCCTTTAACTT Chr13:108842986..108843005 60.26 50
downstream ENSMUSE00000706094 Chr13:108842785..108842843 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAAGGCTCTGGGGATGTAAT Chr13:108909581..108909601 58.07 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATGGGGGCAGGGTTATATGAT Chr13:108942649..108942670 61.47 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GGGGGTTTGAGAGCACTGTAT Chr13:108909801..108909822 60.38 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GGGGGTTTGAGAGCACTGTAT Chr13:108909801..108909822 60.38 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000068184