Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI5689
Trapped Gene
5830434P21Rik (ENSMUSG00000039262)
Vector Insertion
Chr 2: 32043000 - 32043074
Public Clones CSI626 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 9% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000278029 (Chr2:32043001..32043073 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CACAAATTCAGTGCCAGGTG Chr2:32043003..32043022 60.15 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000278029 (Chr2:32043001..32043073 +)
Downstram Exon
ENSMUSE00000695501 (Chr2:32043001..32043073 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CACAAATTCAGTGCCAGGTG Chr2:32043003..32043022 60.15 50 ACTCAGCTGTGCCCATGACT Chr2:32043051..32043070 60.89 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000695545 Chr2:32006668..32006811 No primer for this exon
upstream ENSMUSE00000708709 Chr2:32037978..32038146 GTCAGTAGGCGCTGTCAGGT Chr2:32038121..32038140 60.48 60
upstream ENSMUSE00000715503 Chr2:32037978..32038146 GTCAGTAGGCGCTGTCAGGT Chr2:32038121..32038140 60.48 60
upstream ENSMUSE00000278049 Chr2:32038643..32038820 CAGAGTCTCGGGAAAGTTGC Chr2:32038663..32038682 59.99 55
upstream ENSMUSE00000695506 Chr2:32038643..32038820 CAGAGTCTCGGGAAAGTTGC Chr2:32038663..32038682 59.99 55
upstream ENSMUSE00000278040 Chr2:32040865..32040967 TTTGCAGAAACCGACACAGT Chr2:32040934..32040953 59.34 45
upstream ENSMUSE00000695504 Chr2:32040865..32040967 TTTGCAGAAACCGACACAGT Chr2:32040934..32040953 59.34 45

*** Putative Vector Insertion (Chr 2: 32043000 - 32043074) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000278029 Chr2:32043001..32043073 ACTCAGCTGTGCCCATGACT Chr2:32043051..32043070 60.89 55
downstream ENSMUSE00000695501 Chr2:32043001..32043073 ACTCAGCTGTGCCCATGACT Chr2:32043051..32043070 60.89 55
downstream ENSMUSE00000568008 Chr2:32047029..32047172 AGATCTAAGGCGCCCTTTTC Chr2:32047140..32047159 59.82 50
downstream ENSMUSE00000695498 Chr2:32047029..32047172 AGATCTAAGGCGCCCTTTTC Chr2:32047140..32047159 59.82 50
downstream ENSMUSE00000277988 Chr2:32049283..32049524 GCTCCTTAGAATCGCTGGTG Chr2:32049429..32049448 59.98 55
downstream ENSMUSE00000695493 Chr2:32049283..32049524 GCTCCTTAGAATCGCTGGTG Chr2:32049429..32049448 59.98 55
downstream ENSMUSE00000373850 Chr2:32049900..32050021 CGTTCCACCGTAGTCTGGTT Chr2:32049946..32049965 60.03 55
downstream ENSMUSE00000695488 Chr2:32049900..32050021 CGTTCCACCGTAGTCTGGTT Chr2:32049946..32049965 60.03 55
downstream ENSMUSE00000375006 Chr2:32050377..32050516 CGCATCAGTGTCCAGATCAT Chr2:32050503..32050522 59.66 50
downstream ENSMUSE00000695487 Chr2:32050377..32050516 CGCATCAGTGTCCAGATCAT Chr2:32050503..32050522 59.66 50
downstream ENSMUSE00000342947 Chr2:32054521..32054611 CGGAATAGTCCACTTCCTCGT Chr2:32054549..32054569 60.5 52.38
downstream ENSMUSE00000695486 Chr2:32054521..32054611 CGGAATAGTCCACTTCCTCGT Chr2:32054549..32054569 60.5 52.38
downstream ENSMUSE00000351770 Chr2:32056346..32056538 CTGCAGAGCTCAATGACAGC Chr2:32056398..32056417 59.89 55
downstream ENSMUSE00000695485 Chr2:32056346..32056538 CTGCAGAGCTCAATGACAGC Chr2:32056398..32056417 59.89 55
downstream ENSMUSE00000389886 Chr2:32059529..32059844 GCCTGCACTTCTGGTCTAGC Chr2:32059739..32059758 60.16 60
downstream ENSMUSE00000695484 Chr2:32059529..32059844 GCCTGCACTTCTGGTCTAGC Chr2:32059739..32059758 60.16 60
downstream ENSMUSE00000349219 Chr2:32061856..32062100 GAACATGGTGGGTGCTTCTT Chr2:32061899..32061918 59.97 50
downstream ENSMUSE00000695482 Chr2:32061856..32062100 GAACATGGTGGGTGCTTCTT Chr2:32061899..32061918 59.97 50
downstream ENSMUSE00000355968 Chr2:32064160..32064355 GGTGGTGTGGGTAGAAGGTG Chr2:32064244..32064263 60.28 60
downstream ENSMUSE00000695479 Chr2:32064160..32064355 GGTGGTGTGGGTAGAAGGTG Chr2:32064244..32064263 60.28 60
downstream ENSMUSE00000358805 Chr2:32067595..32067811 GGTCACTTTCCGTTCTTGGA Chr2:32067698..32067717 60.09 50
downstream ENSMUSE00000695477 Chr2:32068407..32070467 GGTTTCTTGATGGGTCCTGA Chr2:32068919..32068938 59.9 50
downstream ENSMUSE00000407171 Chr2:32071566..32071753 TCTTACTGGGGGTTTCAGGA Chr2:32071672..32071691 59.52 50
downstream ENSMUSE00000366749 Chr2:32072132..32072277 CTTCACCCACCACAGAGCTT Chr2:32072203..32072222 60.3 55
downstream ENSMUSE00000277797 Chr2:32072717..32072855 TTTTAGCAAACCGAGGAGGA Chr2:32072774..32072793 59.82 45
downstream ENSMUSE00000277790 Chr2:32074197..32074279 CAGGCTCAGTACTGCTGAAGG Chr2:32074270..32074290 60.2 57.14
downstream ENSMUSE00000277784 Chr2:32074734..32074925 TGCTTCTGAGCTTGGTCCTT Chr2:32074915..32074934 60.13 50
downstream ENSMUSE00000695476 Chr2:32074737..32074925 TGCTTCTGAGCTTGGTCCTT Chr2:32074915..32074934 60.13 50
downstream ENSMUSE00000277780 Chr2:32075060..32075257 TTTTTCAGAGACCGCTCGTT Chr2:32075136..32075155 59.99 45
downstream ENSMUSE00000277778 Chr2:32075610..32075696 GGCAGGCTGAAATCAGAGTC Chr2:32075632..32075651 59.96 55
downstream ENSMUSE00000277774 Chr2:32076600..32076704 GCAGGATGGGAATACTCTGC Chr2:32076633..32076652 59.66 55
downstream ENSMUSE00000277771 Chr2:32076865..32077057 AGCAGAAGGCGCTACAGAAG Chr2:32077050..32077069 59.92 55
downstream ENSMUSE00000277768 Chr2:32077810..32077907 ATCGTTTGAGGAACCAGTCG Chr2:32077885..32077904 60.11 50
downstream ENSMUSE00000277763 Chr2:32078939..32079066 AAGGGATATCGGGATCTGCT Chr2:32078974..32078993 59.89 50
downstream ENSMUSE00000277758 Chr2:32079449..32079689 CTGAGAGGATCATCGTGCTG Chr2:32079507..32079526 59.53 55
downstream ENSMUSE00000277754 Chr2:32081751..32081906 ATACCGAGGCAGTGGCATAG Chr2:32081777..32081796 60.12 55
downstream ENSMUSE00000277750 Chr2:32082465..32082556 GAAGCCTTTCAACTCCATCG Chr2:32082494..32082513 59.81 50
downstream ENSMUSE00000277747 Chr2:32084783..32084864 TGAACGTAGTGTCCCTGCAC Chr2:32084863..32084882 59.75 55
downstream ENSMUSE00000448105 Chr2:32086131..32090011 GCAGAGGACTCGGTCACTTC Chr2:32087991..32088010 59.99 60
downstream ENSMUSE00000645974 Chr2:32086131..32090011 GCAGAGGACTCGGTCACTTC Chr2:32087991..32088010 59.99 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGGCACAGCTGAGTGTAAT Chr2:32043035..32043055 59.32 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCTGAGCTGGCTCTTCTTGT Chr2:32042965..32042985 59.9 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039262