Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI569
Trapped Gene
Jmjd1c (ENSMUSG00000037876)
Vector Insertion
Chr 10: 66652598 - 66678017
Public Clones BB0565 (sanger) (sanger) DA0191 (sanger) AW0305 (sanger) (sanger)
RST276 (baygenomics) RRS338 (baygenomics) Ex182 (baygenomics) TEA171 (baygenomics)
D028B08 (ggtc) P118H06 (ggtc) PST4379-NL (escells)
Private Clones OST456267 (lexicon) OST377377 (lexicon) OST208419 (lexicon) OST186195 (lexicon)
OST83418 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000642903 (Chr10:66652484..66652597 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTGCCTTTCAGCCATACCAG Chr10:66652578..66652597 60.66 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000642903 (Chr10:66652484..66652597 +)
Downstram Exon
ENSMUSE00000642902 (Chr10:66678018..66678123 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTGCCTTTCAGCCATACCAG Chr10:66652578..66652597 60.66 55 GTCCCTGAGTACGGGCTTTA Chr10:66678056..66678075 59.19 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000419774 Chr10:66648728..66649059 TGCTTCGTTCTGTGGTCTTG Chr10:66648813..66648832 60.03 50
upstream ENSMUSE00000642903 Chr10:66652484..66652597 GTGCCTTTCAGCCATACCAG Chr10:66652578..66652597 60.66 55

*** Putative Vector Insertion (Chr 10: 66652598 - 66678017) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000642902 Chr10:66678018..66678123 GTCCCTGAGTACGGGCTTTA Chr10:66678056..66678075 59.19 55
downstream ENSMUSE00000642884 Chr10:66679731..66679855 TGGGTGGCAGAATCTTGTCT Chr10:66679791..66679810 60.66 50
downstream ENSMUSE00000289838 Chr10:66680786..66680929 GACCTTCGCCGTGATGTAAT Chr10:66680901..66680920 59.96 50
downstream ENSMUSE00000289832 Chr10:66681025..66681217 GCTGGTCTGGGACTATTTGC Chr10:66681068..66681087 59.7 55
downstream ENSMUSE00000575821 Chr10:66681702..66683383 CTGCCTCGAGTAGGAACTGG Chr10:66682773..66682792 60.01 60
downstream ENSMUSE00000575819 Chr10:66686757..66686929 ATACCATCCGCTGAGGTCAC Chr10:66686815..66686834 59.96 55
downstream ENSMUSE00000371587 Chr10:66687485..66689667 AAGGGTGTAGAGGCCGAAAT Chr10:66688882..66688901 59.96 50
downstream ENSMUSE00000289729 Chr10:66692596..66692797 AAGTCTGCACTCTCGGCACT Chr10:66692732..66692751 60.21 55
downstream ENSMUSE00000289722 Chr10:66694720..66694934 CAACGCTGTTTTCTCAGACG Chr10:66694918..66694937 59.63 50
downstream ENSMUSE00000289712 Chr10:66696119..66696271 GTGGACGTTGAACAGTGTGG Chr10:66696201..66696220 60.05 55
downstream ENSMUSE00000289707 Chr10:66700856..66700945 GCTGGCCTTTCACACACTTC Chr10:66700900..66700919 60.84 55
downstream ENSMUSE00000289699 Chr10:66701555..66701682 AAGAATGTGCATGGCATCAA Chr10:66701592..66701611 60.08 40
downstream ENSMUSE00000289693 Chr10:66701997..66702207 CTTGCACTTCCAGGGCTACT Chr10:66702118..66702137 59.5 55
downstream ENSMUSE00000666227 Chr10:66701997..66702177 CTTGCACTTCCAGGGCTACT Chr10:66702118..66702137 59.5 55
downstream ENSMUSE00000575817 Chr10:66702610..66702824 TGGTCAGCAAATCACGTAGG Chr10:66702750..66702769 59.72 50
downstream ENSMUSE00000289677 Chr10:66703411..66703689 TGCTGGTCACAGATCCAAGA Chr10:66703619..66703638 60.4 50
downstream ENSMUSE00000289672 Chr10:66706520..66706688 CTCCTTAACGTTGGCATTGG Chr10:66706663..66706682 60.49 50
downstream ENSMUSE00000289662 Chr10:66707531..66707621 CTTGAAGTCCTCCCCAGATG Chr10:66707607..66707626 59.65 55
downstream ENSMUSE00000289657 Chr10:66708254..66708384 ACAAAGAACCCTGGCAAATG Chr10:66708349..66708368 59.97 45
downstream ENSMUSE00000666226 Chr10:66708361..66708384 No primer for this exon
downstream ENSMUSE00000289650 Chr10:66708782..66708904 AGAGGACGCCATTTCCTTTT Chr10:66708898..66708917 60.07 45
downstream ENSMUSE00000289640 Chr10:66710759..66710898 CACCAGGGATTTCACTCGAA Chr10:66710842..66710861 61.03 50
downstream ENSMUSE00000289631 Chr10:66712378..66712554 GTCTCTGGCGGAGCTTTCTA Chr10:66712471..66712490 59.72 55
downstream ENSMUSE00000612311 Chr10:66717200..66717331 TCTTCGGTCACCTGAACACA Chr10:66717240..66717259 60.28 50
downstream ENSMUSE00000642890 Chr10:66718196..66719066 CCAACCGCAATTAGGTGTCT Chr10:66718298..66718317 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CATAATCGCCTTGCAGCACA Chr10:66673647..66673667 63.21 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGTTTAACAGAGGCGTGACT Chr10:66673635..66673656 59.79 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037876