Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI5744
Trapped Gene
Pmm1 (ENSMUSG00000022474)
Vector Insertion
Chr 15: 81782470 - 81783154
Public Clones CSI408 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 61% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000127325 (Chr15:81783155..81783230 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAGGAGAAGATCCGGGAGAA Chr15:81783211..81783230 60.15 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000127325 (Chr15:81783155..81783230 -)
Downstram Exon
ENSMUSE00000127332 (Chr15:81782354..81782469 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAGGAGAAGATCCGGGAGAA Chr15:81783211..81783230 60.15 50 TCCAGGCAGTAGCGCTTATC Chr15:81782390..81782409 60.51 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000394648 Chr15:81791145..81791294 CATCCTCTGCCTGTTTGACG Chr15:81791174..81791193 61.8 55
upstream ENSMUSE00000680688 Chr15:81788326..81788340 No primer for this exon
upstream ENSMUSE00000127320 Chr15:81788223..81788340 ACTCTAAGATCGCCGAGCAG Chr15:81788242..81788261 59.74 55
upstream ENSMUSE00000127321 Chr15:81786792..81786868 GGACGGCTACTCTCCAAACA Chr15:81786793..81786812 60.26 55
upstream ENSMUSE00000127330 Chr15:81786599..81786690 TTAGCTACATGGCCCTGCTC Chr15:81786616..81786635 60.37 55
upstream ENSMUSE00000398536 Chr15:81786079..81786178 TGGAGGAGAGGATCGAGTTC Chr15:81786094..81786113 59.33 55
upstream ENSMUSE00000127325 Chr15:81783155..81783230 AAGGAGAAGATCCGGGAGAA Chr15:81783211..81783230 60.15 50

*** Putative Vector Insertion (Chr 15: 81782470 - 81783154) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000127332 Chr15:81782354..81782469 TCCAGGCAGTAGCGCTTATC Chr15:81782390..81782409 60.51 55
downstream ENSMUSE00000484589 Chr15:81781542..81782042 GGGTCCGCATAGATCTCAAA Chr15:81781989..81782008 60.04 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GACAGAGTTTGCTGGCAAGG Chr15:81783171..81783191 60.97 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GACAGAGTTTGCTGGCAAGG Chr15:81783171..81783191 60.97 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022474