Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI5748
Trapped Gene
Dnm2 (ENSMUSG00000033335)
Vector Insertion
Chr 9: 21270176 - 21271975
Public Clones CSI438 (baygenomics) IST12456D4 (tigm)
Private Clones OST440941 (lexicon) OST388228 (lexicon) OST266011 (lexicon) OST149002 (lexicon)
Severity of mutation (?) Insertion after 15% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000584898 (Chr9:21270026..21270175 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TATGCGGAATTTTTGCACTG Chr9:21270028..21270047 59.7 40 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000584898 (Chr9:21270026..21270175 +)
Downstram Exon
ENSMUSE00000584897 (Chr9:21271976..21272179 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TATGCGGAATTTTTGCACTG Chr9:21270028..21270047 59.7 40 GGTCGATGAGGGTCAAGTTC Chr9:21272002..21272021 59.51 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000476895 Chr9:21229415..21229700 ACATCGGAACCGAGAGTCTT Chr9:21229487..21229506 58.74 50
upstream ENSMUSE00000584899 Chr9:21261947..21262020 CTTCCTTCCACGAGGATCAG Chr9:21261950..21261969 59.8 55
upstream ENSMUSE00000584898 Chr9:21270026..21270175 TATGCGGAATTTTTGCACTG Chr9:21270028..21270047 59.7 40

*** Putative Vector Insertion (Chr 9: 21270176 - 21271975) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000584897 Chr9:21271976..21272179 GGTCGATGAGGGTCAAGTTC Chr9:21272002..21272021 59.51 55
downstream ENSMUSE00000584896 Chr9:21275787..21275885 ATGACACCGATGGTCCGTAG Chr9:21275811..21275830 60.8 55
downstream ENSMUSE00000584895 Chr9:21277057..21277217 TTTTTGCCCTCGATGTCTTT Chr9:21277108..21277127 59.69 40
downstream ENSMUSE00000638336 Chr9:21278976..21279118 TCAGGCCGGAAATTCTTGTA Chr9:21279088..21279107 60.58 45
downstream ENSMUSE00000584893 Chr9:21280917..21281052 AGCCTTCAATTCGCTTCTCA Chr9:21280966..21280985 60.1 45
downstream ENSMUSE00000638335 Chr9:21282725..21282787 No primer for this exon
downstream ENSMUSE00000702744 Chr9:21282725..21282792 No primer for this exon
downstream ENSMUSE00000638334 Chr9:21283038..21283042 No primer for this exon
downstream ENSMUSE00000584892 Chr9:21283343..21283481 CAGGGCTCTTTCAGCTTGAC Chr9:21283420..21283439 60.13 55
downstream ENSMUSE00000638333 Chr9:21284851..21284989 GACACCACCAGGTCAACACA Chr9:21284955..21284974 60.48 55
downstream ENSMUSE00000584891 Chr9:21285777..21285863 CCTTCTCGCTCCCTGATGTA Chr9:21285850..21285869 60.35 55
downstream ENSMUSE00000584890 Chr9:21290095..21290165 TTGGCAAATCCAATGAAGTC Chr9:21290168..21290187 58.55 40
downstream ENSMUSE00000584889 Chr9:21294187..21294238 GGGTATGGCCCTCTTCTTGT Chr9:21294235..21294254 60.33 55
downstream ENSMUSE00000702763 Chr9:21295102..21295113 No primer for this exon
downstream ENSMUSE00000638331 Chr9:21298948..21299061 GCTGTCAGCACGAACCAGTA Chr9:21299033..21299052 60.06 55
downstream ENSMUSE00000638330 Chr9:21303702..21303811 AAACACGTGCTTGTTGGACA Chr9:21303791..21303810 60.2 45
downstream ENSMUSE00000584885 Chr9:21304702..21304813 CTGGGAGTCACAAGCCAGTT Chr9:21304753..21304772 60.3 55
downstream ENSMUSE00000638329 Chr9:21307986..21308150 CACGGATGGACTTGTTGATG Chr9:21308112..21308131 59.96 50
downstream ENSMUSE00000584881 Chr9:21308874..21309106 CTCCTTCAGTGCGTGGTACA Chr9:21309011..21309030 59.9 55
downstream ENSMUSE00000584860 Chr9:21309908..21310159 GTGCACACTGGACACAGGTC Chr9:21309947..21309966 60.22 60
downstream ENSMUSE00000584869 Chr9:21310777..21311568 TCATACAGCCCAAACCACAA Chr9:21311419..21311438 59.96 45
downstream ENSMUSE00000584874 Chr9:21310780..21310846 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACCTTCGGGTCTACTCACCA Chr9:21270153..21270173 59.57 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACCTTCGGGTCTACTCACCA Chr9:21270153..21270173 59.57 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000033335