Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI576
Trapped Gene
AC160147.6 (ENSMUSG00000061983)
Vector Insertion
Chr 10: 23505811 - 23506569
Public Clones XT0579 (sanger) CJ0148 (sanger) AG0083 (sanger) CC0010 (sanger)
BA0704 (sanger) CH0543 (sanger) DD0656 (sanger) XT0339 (sanger)
DD0487 (sanger) AM0737 (sanger) DD0017 (sanger) RRF516 (baygenomics)
PST15607-NR (escells) PST14915-NL (escells) PST15329-NR (escells) IST10459D7 (tigm)
Private Clones OST78431 (lexicon)
Severity of mutation (?) Insertion after 34% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000467687 (Chr10:23506570..23506686 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGCTGCTGGAGGTGTAATGG Chr10:23506664..23506683 60.28 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000467687 (Chr10:23506570..23506686 -)
Downstram Exon
ENSMUSE00000469732 (Chr10:23505708..23505810 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGCTGCTGGAGGTGTAATGG Chr10:23506664..23506683 60.28 55 GCCTCCACCAGCTTGACATA Chr10:23505720..23505739 61.21 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000416964 Chr10:23506962..23507005 No primer for this exon
upstream ENSMUSE00000461522 Chr10:23506800..23506850 No primer for this exon
upstream ENSMUSE00000467687 Chr10:23506570..23506686 AGCTGCTGGAGGTGTAATGG Chr10:23506664..23506683 60.28 55

*** Putative Vector Insertion (Chr 10: 23505811 - 23506569) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000469732 Chr10:23505708..23505810 GCCTCCACCAGCTTGACATA Chr10:23505720..23505739 61.21 55
downstream ENSMUSE00000510690 Chr10:23505382..23505483 TGCCCTCTCGATCGATTTTA Chr10:23505401..23505420 60.68 45
downstream ENSMUSE00000409210 Chr10:23505003..23505079 GATGACATCCTTGGCCTGAG Chr10:23505022..23505041 60.62 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCCGGAACAAAGACTAATCG Chr10:23506512..23506532 59.71 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCAATACTGTGGGGTGTTGC Chr10:23506533..23506553 59.42 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 ACGTCTCTGTCTGCATTCCA Chr10:23506686..23506706 59.42 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 AGCTGCTGGAGGTGTAATGG Chr10:23506662..23506682 60.28 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000061983