Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI5765
Trapped Gene
Ppil4 (ENSMUSG00000015757)
Vector Insertion
Chr 10: 7512819 - 7515441
Public Clones CSI158 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 5% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000373984 (Chr10:7512728..7512818 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000373984 (Chr10:7512728..7512818 +)
Downstram Exon
ENSMUSE00000098107 (Chr10:7515442..7515509 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000373984 Chr10:7512728..7512818 No primer for this exon

*** Putative Vector Insertion (Chr 10: 7512819 - 7515441) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000098107 Chr10:7515442..7515509 No primer for this exon
downstream ENSMUSE00000098109 Chr10:7515595..7515659 No primer for this exon
downstream ENSMUSE00000098113 Chr10:7517556..7517673 No primer for this exon
downstream ENSMUSE00000098111 Chr10:7518213..7518355 No primer for this exon
downstream ENSMUSE00000098105 Chr10:7519351..7519447 No primer for this exon
downstream ENSMUSE00000098108 Chr10:7520532..7520648 No primer for this exon
downstream ENSMUSE00000098112 Chr10:7521643..7521767 No primer for this exon
downstream ENSMUSE00000098103 Chr10:7524754..7524820 No primer for this exon
downstream ENSMUSE00000098104 Chr10:7527069..7527180 No primer for this exon
downstream ENSMUSE00000322427 Chr10:7530160..7530256 No primer for this exon
downstream ENSMUSE00000322422 Chr10:7534462..7534609 No primer for this exon
downstream ENSMUSE00000360241 Chr10:7540750..7542358 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAATAATCGCCTTGCAGCAC Chr10:7512867..7512887 61.69 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGTCATCGACTTGTACACTGA Chr10:7512784..7512806 59.21 45.46 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000015757