Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI5772
Trapped Gene
Mycbp2 (ENSMUSG00000033004)
Vector Insertion
Chr 14: 103684626 - 103686422
Public Clones CSI367 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 13% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000417156 (Chr14:103686423..103686587 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGGCAGTCAAAGCCCTATAA Chr14:103686557..103686576 60.22 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000417156 (Chr14:103686423..103686587 -)
Downstram Exon
ENSMUSE00000417154 (Chr14:103684467..103684625 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGGCAGTCAAAGCCCTATAA Chr14:103686557..103686576 60.22 50 CACCAGTGTCTCGTCCACAT Chr14:103684466..103684485 59.58 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000417209 Chr14:103745433..103746017 CGCTACCGGAGGATTTACAC Chr14:103745490..103745509 59.59 55
upstream ENSMUSE00000417204 Chr14:103722887..103722962 TTGAAGCGAAAACAGAAAAGC Chr14:103722914..103722934 59.64 38.1
upstream ENSMUSE00000417198 Chr14:103713516..103713731 CAGCTGCATCGAAAAACTCA Chr14:103713585..103713604 60.13 45
upstream ENSMUSE00000417193 Chr14:103705407..103705560 CTGCTGAATGTGCTTCAAGG Chr14:103705451..103705470 59.59 50
upstream ENSMUSE00000417188 Chr14:103697884..103698080 CAGTCACGCTTGCCAAACTA Chr14:103697889..103697908 60.05 50
upstream ENSMUSE00000417185 Chr14:103696397..103696639 AGGCAGTGTTGGTTGGAAAG Chr14:103696583..103696602 60.15 50
upstream ENSMUSE00000417181 Chr14:103696110..103696181 No primer for this exon
upstream ENSMUSE00000417177 Chr14:103694377..103694473 GCCCTGAGACACTGGAACAG Chr14:103694399..103694418 60.86 60
upstream ENSMUSE00000417172 Chr14:103690506..103690579 ATTGCCACACTGAAGGTCAA Chr14:103690560..103690579 59.14 45
upstream ENSMUSE00000417169 Chr14:103690235..103690373 TTACACGCCTGTGGCATATC Chr14:103690270..103690289 59.57 50
upstream ENSMUSE00000417162 Chr14:103688761..103688837 ATACTCGGTGCAGGACGAGA Chr14:103688792..103688811 60.82 55
upstream ENSMUSE00000417159 Chr14:103687760..103687964 ACAAGGTGGTCCTTCAGCAG Chr14:103687907..103687926 60.3 55
upstream ENSMUSE00000417156 Chr14:103686423..103686587 CGGCAGTCAAAGCCCTATAA Chr14:103686557..103686576 60.22 50

*** Putative Vector Insertion (Chr 14: 103684626 - 103686422) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000417154 Chr14:103684467..103684625 CACCAGTGTCTCGTCCACAT Chr14:103684466..103684485 59.58 55
downstream ENSMUSE00000417147 Chr14:103681815..103682019 CCAGGTCTTCATCCATTGCT Chr14:103681953..103681972 60.07 50
downstream ENSMUSE00000417143 Chr14:103675590..103675735 GCTTCTTGACCGTCCAACTC Chr14:103675627..103675646 59.85 55
downstream ENSMUSE00000417139 Chr14:103675006..103675107 GACACGTTGCCGTTTTTCTT Chr14:103675015..103675034 60.15 45
downstream ENSMUSE00000417134 Chr14:103668575..103668682 GTGCTTGTCCCGTTTATGCT Chr14:103668557..103668576 60.14 50
downstream ENSMUSE00000417129 Chr14:103661919..103662038 GTGATTTTGCTTGCGTCCTT Chr14:103661974..103661993 60.26 45
downstream ENSMUSE00000417127 Chr14:103659413..103659494 GCTGCCCATATCCAAAGGTA Chr14:103659425..103659444 59.92 50
downstream ENSMUSE00000417124 Chr14:103651626..103651743 TGTGAAGACCTGTCCATCCA Chr14:103651619..103651638 60.09 50
downstream ENSMUSE00000417120 Chr14:103647579..103647783 AATGTTAGGCATGGGAGCTG Chr14:103647690..103647709 60.1 50
downstream ENSMUSE00000417114 Chr14:103646964..103647117 CACCAAATCCTTGCAGGTCT Chr14:103646976..103646995 60.11 50
downstream ENSMUSE00000416437 Chr14:103642261..103642433 CAACCACGGCATTGTAACAC Chr14:103642365..103642384 59.89 50
downstream ENSMUSE00000416428 Chr14:103641539..103641664 GCATAGCAGCCAAAGTGTCA Chr14:103641616..103641635 60.02 50
downstream ENSMUSE00000416421 Chr14:103641329..103641456 ACTGAATGGGCAGAGTAGCC Chr14:103641398..103641417 59.31 55
downstream ENSMUSE00000416416 Chr14:103631743..103631834 GAAGGTCTCCATCCGTTTCA Chr14:103631761..103631780 60.05 50
downstream ENSMUSE00000416409 Chr14:103628572..103628706 GACACTCGAGCCCATGCTAC Chr14:103628607..103628626 60.83 60
downstream ENSMUSE00000416403 Chr14:103626688..103626771 No primer for this exon
downstream ENSMUSE00000416398 Chr14:103624636..103624732 GAGGTACTGCCGTCACTGGT Chr14:103624684..103624703 60.18 60
downstream ENSMUSE00000416393 Chr14:103623484..103623676 CAGGTGTAGACGCGCAGTAA Chr14:103623482..103623501 60.07 55
downstream ENSMUSE00000416388 Chr14:103622127..103622401 GAAGGTGTTGTGGCACTCCT Chr14:103622186..103622205 60.16 55
downstream ENSMUSE00000416382 Chr14:103619144..103619356 CTTAACAATCGATCGCAGCA Chr14:103619200..103619219 59.98 45
downstream ENSMUSE00000416376 Chr14:103614537..103614728 CTCCGAAGGCTGTTTCTCAC Chr14:103614612..103614631 59.99 55
downstream ENSMUSE00000416371 Chr14:103611740..103611946 CAGGTTTGTCGACTGCAAAA Chr14:103611795..103611814 59.88 45
downstream ENSMUSE00000416366 Chr14:103610475..103610606 No primer for this exon
downstream ENSMUSE00000416359 Chr14:103607966..103608144 CATAGTTCCTCAAGCGCACA Chr14:103608086..103608105 60.01 50
downstream ENSMUSE00000416352 Chr14:103605853..103605995 CAGCTCGAACAACAGTGCTT Chr14:103605867..103605886 59.24 50
downstream ENSMUSE00000416347 Chr14:103604394..103604494 AATAGCAGCGGCTACTGGTC Chr14:103604378..103604397 59.5 55
downstream ENSMUSE00000416341 Chr14:103603539..103603757 GGCTTGTATGGGTGCTCACT Chr14:103603539..103603558 60.14 55
downstream ENSMUSE00000416331 Chr14:103600429..103600654 CAGGAATAAGCAAACGGATGA Chr14:103600536..103600556 60.08 42.86
downstream ENSMUSE00000416323 Chr14:103599291..103599409 CTCATCAGGTCCAGGGCTAA Chr14:103599269..103599288 60.21 55
downstream ENSMUSE00000416318 Chr14:103598650..103598737 GCAGTGCGAGATCCTTCTTC Chr14:103598634..103598653 60.1 55
downstream ENSMUSE00000416313 Chr14:103597857..103597906 CAATGCAGCCTCTTCAAGAAT Chr14:103597838..103597858 59.47 42.86
downstream ENSMUSE00000416307 Chr14:103596462..103596634 GATTTGAAGCGGCAAGTTTC Chr14:103596514..103596533 59.83 45
downstream ENSMUSE00000416299 Chr14:103595455..103595599 ACATGAACCACATCGCCATA Chr14:103595446..103595465 59.81 45
downstream ENSMUSE00000416295 Chr14:103593801..103594010 AGTCATGTCGGCGCTAGAAG Chr14:103593869..103593888 60.56 55
downstream ENSMUSE00000416291 Chr14:103590784..103590839 CTTTTCGGAGTTGGTGATGC Chr14:103590762..103590781 60.64 50
downstream ENSMUSE00000416287 Chr14:103587716..103587831 TCCCATCGTTATTGACACGA Chr14:103587769..103587788 59.92 45
downstream ENSMUSE00000416281 Chr14:103584801..103584898 GTCTGCCTTCGGCTTGACTA Chr14:103584794..103584813 60.54 55
downstream ENSMUSE00000416275 Chr14:103584049..103584165 GTCCTTGGCCACAAATTTTC Chr14:103584120..103584139 59.41 45
downstream ENSMUSE00000416269 Chr14:103581571..103581711 TTGCCAAGATGCTGGTTAAA Chr14:103581571..103581590 59.3 40
downstream ENSMUSE00000416266 Chr14:103576473..103576547 CCTGACTCCTTGGCTAGCAT Chr14:103576496..103576515 59.45 55
downstream ENSMUSE00000416260 Chr14:103573983..103574207 TCTCGTTCTTGCATTGTTGC Chr14:103574106..103574125 59.99 45
downstream ENSMUSE00000416255 Chr14:103573004..103573136 TGCCGTAGGTACTGGTTTCC Chr14:103572990..103573009 59.99 55
downstream ENSMUSE00000416252 Chr14:103571784..103571906 GCAACTTGCCCCTTTATTGA Chr14:103571802..103571821 60.07 45
downstream ENSMUSE00000416249 Chr14:103569074..103569229 ATTGGGCCGTGATTGAATAG Chr14:103569161..103569180 59.78 45
downstream ENSMUSE00000350096 Chr14:103554341..103555984 CGAGGTGGGTCAAGTTTTGT Chr14:103555506..103555525 60.01 50
downstream ENSMUSE00000385459 Chr14:103553963..103554132 CACAGTTACCAGCCCATCCT Chr14:103554036..103554055 59.99 55
downstream ENSMUSE00000399910 Chr14:103553143..103553387 TGCAGGGTGGTAACACAAGA Chr14:103553216..103553235 60.15 50
downstream ENSMUSE00000336900 Chr14:103551337..103551504 ATTGGGACTTGCATCAGGAG Chr14:103551359..103551378 60.07 50
downstream ENSMUSE00000253730 Chr14:103547725..103547882 GCCAGGTCAGTGTCGGTTAT Chr14:103547825..103547844 60 55
downstream ENSMUSE00000253724 Chr14:103546050..103546246 ACGGCAAGCAGACTTCCTTA Chr14:103546043..103546062 60.01 50
downstream ENSMUSE00000253717 Chr14:103545117..103545266 GTCAGTGCAGCCACAAAGTG Chr14:103545165..103545184 60.51 55
downstream ENSMUSE00000253708 Chr14:103543471..103543631 GCTTCGCCTGCAATCACTAT Chr14:103543551..103543570 60.38 50
downstream ENSMUSE00000253702 Chr14:103542360..103542516 AGGAACTGGTGATCGGACTG Chr14:103542453..103542472 60.11 55
downstream ENSMUSE00000483356 Chr14:103541961..103542185 CGGGTCGACTTGATGTTTTT Chr14:103542094..103542113 59.97 45
downstream ENSMUSE00000253689 Chr14:103540088..103540153 TTCTGCACAGCTCTTCTACTGC Chr14:103540074..103540095 59.97 50
downstream ENSMUSE00000253679 Chr14:103538454..103538693 TTATCCCCTCCTGGGAGTTC Chr14:103538613..103538632 60.26 55
downstream ENSMUSE00000467400 Chr14:103537937..103538035 TCAGCGTCTCCAGAGATGAG Chr14:103537982..103538001 59.23 55
downstream ENSMUSE00000253664 Chr14:103535776..103535856 TCCAACCATGTGTTCCTTCA Chr14:103535796..103535815 59.94 45
downstream ENSMUSE00000253657 Chr14:103534251..103534517 GCGAATAGCTTGGACGATGT Chr14:103534466..103534485 60.24 50
downstream ENSMUSE00000465018 Chr14:103532999..103533282 GCCAGACGGTTAGGAGTCAC Chr14:103533208..103533227 59.73 60
downstream ENSMUSE00000253645 Chr14:103530460..103530556 GAGTTGAGCCCTTCATCCAC Chr14:103530488..103530507 59.66 55
downstream ENSMUSE00000253640 Chr14:103529148..103529267 AAGGCAATGATGGTTTCTGC Chr14:103529181..103529200 60.08 45
downstream ENSMUSE00000362574 Chr14:103527130..103527231 TCAAGAACACACAGCGATGC Chr14:103527175..103527194 61.03 50
downstream ENSMUSE00000336423 Chr14:103526281..103526409 TGCAGTTTCACCGTCATCAT Chr14:103526352..103526371 60.12 45
downstream ENSMUSE00000385238 Chr14:103525839..103525971 TGTTCTCGGAATTCCACCAT Chr14:103525822..103525841 60.32 45
downstream ENSMUSE00000350046 Chr14:103523616..103523719 AGCTACTCGTGGTGGGTTTG Chr14:103523677..103523696 60.17 55
downstream ENSMUSE00000357280 Chr14:103522529..103522717 ACTGCAGGCGATCTTAGCAT Chr14:103522672..103522691 60.01 50
downstream ENSMUSE00000253600 Chr14:103521732..103521839 CCGACAGCACTGTAAGTGGA Chr14:103521779..103521798 59.9 55
downstream ENSMUSE00000253594 Chr14:103519723..103519932 AACCTGACACCAGGAGTCGT Chr14:103519768..103519787 59.6 55
downstream ENSMUSE00000253586 Chr14:103517258..103517365 GCTCTCTGGGGTCGTAATCA Chr14:103517274..103517293 60.22 55
downstream ENSMUSE00000253580 Chr14:103516272..103516437 AGAAGACAGCCACCGAACAG Chr14:103516346..103516365 60.44 55
downstream ENSMUSE00000415863 Chr14:103512630..103513452 CACCCGAGAGCAAACTCTTC Chr14:103513346..103513365 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTAATCGCCTTGCAGCACAT Chr14:103686352..103686372 61.69 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCTTGCTAATTCGTGACTGG Chr14:103686362..103686382 58.38 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000033004