Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI5778
Trapped Gene
Lap3 (ENSMUSG00000039682)
Vector Insertion
Chr 5: 45898449 - 45900676
Public Clones CSI483 (baygenomics) G031D09 (ggtc) G071D08 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 76% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000287231 (Chr5:45898346..45898448 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAATGCTGCCACCTTAACAG Chr5:45898429..45898448 59.34 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000287231 (Chr5:45898346..45898448 +)
Downstram Exon
ENSMUSE00000287221 (Chr5:45900677..45900756 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAATGCTGCCACCTTAACAG Chr5:45898429..45898448 59.34 50 AGCCAGGACGAATTGGTAAA Chr5:45900740..45900759 59.57 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000287307 Chr5:45884699..45884800 TGGGAGTGAGAGGTCTCTGG Chr5:45884748..45884767 60.39 60
upstream ENSMUSE00000287289 Chr5:45886405..45886520 CAAGTGCGGGAGAGAGTTTT Chr5:45886460..45886479 59.47 50
upstream ENSMUSE00000287283 Chr5:45888159..45888213 TCTGGACCTCCTCTCAAAGC Chr5:45888160..45888179 59.53 55
upstream ENSMUSE00000287276 Chr5:45888568..45888673 GATCGGCTGGAGTTGATGAC Chr5:45888605..45888624 60.63 55
upstream ENSMUSE00000287270 Chr5:45889673..45889832 AAGGAGCTGTGCTTGGTCTC Chr5:45889751..45889770 59.6 55
upstream ENSMUSE00000287264 Chr5:45891642..45891806 CCAACCAGATTCGCTGAAAT Chr5:45891736..45891755 60.07 45
upstream ENSMUSE00000287253 Chr5:45894619..45894777 GTGTAGCCAAGGGGTCTGAA Chr5:45894663..45894682 60.11 55
upstream ENSMUSE00000287241 Chr5:45895962..45896086 TTCTGCAAACATGGACCTCA Chr5:45895983..45896002 60.24 45
upstream ENSMUSE00000287235 Chr5:45897413..45897501 ATGTCGTCAGAGCCAGGAAT Chr5:45897467..45897486 59.69 50
upstream ENSMUSE00000287231 Chr5:45898346..45898448 CAATGCTGCCACCTTAACAG Chr5:45898429..45898448 59.34 50

*** Putative Vector Insertion (Chr 5: 45898449 - 45900676) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000287221 Chr5:45900677..45900756 AGCCAGGACGAATTGGTAAA Chr5:45900740..45900759 59.57 45
downstream ENSMUSE00000287216 Chr5:45902347..45902456 GACTCGGTCCCCAGTTTCTAC Chr5:45902375..45902395 59.99 57.14
downstream ENSMUSE00000467351 Chr5:45903120..45903394 TGTGCCCACTTCGTATGTGT Chr5:45903188..45903207 60.03 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000039682