Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI5799
Trapped Gene
Thop1 (ENSMUSG00000004929)
Vector Insertion
Chr 10: 80542983 - 80543157
Public Clones CSH703 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 61% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000102068 (Chr10:80542616..80542982 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000102068 (Chr10:80542616..80542982 +)
Downstram Exon
ENSMUSE00000102062 (Chr10:80543158..80543359 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000392520 Chr10:80532862..80533023 No primer for this exon
upstream ENSMUSE00000303650 Chr10:80535898..80536110 No primer for this exon
upstream ENSMUSE00000102064 Chr10:80538256..80538404 No primer for this exon
upstream ENSMUSE00000435878 Chr10:80539688..80539795 No primer for this exon
upstream ENSMUSE00000102067 Chr10:80540658..80540760 No primer for this exon
upstream ENSMUSE00000102082 Chr10:80541215..80541375 No primer for this exon
upstream ENSMUSE00000102078 Chr10:80542203..80542338 No primer for this exon
upstream ENSMUSE00000102068 Chr10:80542616..80542982 No primer for this exon

*** Putative Vector Insertion (Chr 10: 80542983 - 80543157) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000102062 Chr10:80543158..80543359 No primer for this exon
downstream ENSMUSE00000102074 Chr10:80543772..80543958 No primer for this exon
downstream ENSMUSE00000102072 Chr10:80544052..80544180 No primer for this exon
downstream ENSMUSE00000102071 Chr10:80544345..80544481 No primer for this exon
downstream ENSMUSE00000435875 Chr10:80544609..80544964 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGGGCAGAGGAGTAGGAAGT Chr10:80543009..80543029 59.7 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGGGCAGAGGAGTAGGAAGT Chr10:80543009..80543029 59.7 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000004929