Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI581
Trapped Gene
Yap1 (ENSMUSG00000053110)
Vector Insertion
Chr 9: 7973912 - 8001456
Public Clones BB0600 (sanger) BA0065 (sanger) BC0533 (sanger) CB0053 (sanger)
Q023C03 (ggtc) D188E09 (ggtc) E036B02 (ggtc) D188E09 (ggtc) (ggtc)
E036B02 (ggtc) D128H10 (ggtc) IST15045F4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 36% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000456667 (Chr9:8001457..8001707 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAGCATGTTCGAGCTCACTC Chr9:8001649..8001668 59.73 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000456667 (Chr9:8001457..8001707 -)
Downstram Exon
ENSMUSE00000517511 (Chr9:7973796..7973911 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAGCATGTTCGAGCTCACTC Chr9:8001649..8001668 59.73 55 CAGAATTCATCAGCGTCTGG Chr9:7973780..7973799 59.39 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000456684 Chr9:8004115..8004594 CGTCTGGAGCCAAAGTTTCT Chr9:8004570..8004589 59.47 50
upstream ENSMUSE00000539850 Chr9:8004115..8004588 GCAAAGAAAGGGAGGAAGGA Chr9:8004520..8004539 60.68 50
upstream ENSMUSE00000456667 Chr9:8001457..8001707 CAGCATGTTCGAGCTCACTC Chr9:8001649..8001668 59.73 55

*** Putative Vector Insertion (Chr 9: 7973912 - 8001456) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000517511 Chr9:7973796..7973911 CAGAATTCATCAGCGTCTGG Chr9:7973780..7973799 59.39 50
downstream ENSMUSE00000456652 Chr9:7962289..7962402 ATCCTGAGTCATGGCTTGCT Chr9:7962340..7962359 59.83 50
downstream ENSMUSE00000456648 Chr9:7952953..7953134 TTTCAACCGCAGTCTCTCCT Chr9:7952952..7952971 59.99 50
downstream ENSMUSE00000539852 Chr9:7950492..7950539 CATTTTGGAGCATTTGCTGT Chr9:7950474..7950493 58.77 40
downstream ENSMUSE00000456644 Chr9:7938408..7938538 TGCTCCAGTGTAGGCAACTG Chr9:7938479..7938498 60.05 55
downstream ENSMUSE00000456638 Chr9:7936515..7936627 GAGGGATGCTGTAGCTGCTC Chr9:7936538..7936557 60.13 60
downstream ENSMUSE00000456673 Chr9:7931999..7934732 AGAGAAAAGCGGAACAACGA Chr9:7934332..7934351 59.99 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGGGTCAACCTCTTTAATCG Chr9:7989399..7989419 58.5 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCCCAAACATACCCACGTAA Chr9:7995416..7995436 60.62 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TTGAACGTCCTTGCTTCTGA Chr9:7977658..7977678 59.57 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CTGACCGTGACTGGGAAAAC Chr9:7995642..7995662 60.54 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000053110