Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI5812
Trapped Gene
Naca (ENSMUSG00000061315)
Vector Insertion
Chr 10: 127473617 - 127476226
Public Clones (sanger) (sanger) (sanger) YHB065 (baygenomics) YHD032 (baygenomics)
XG255 (baygenomics) CSG158 (baygenomics) CSH880 (baygenomics) E123E04 (ggtc)
(ggtc) W243E05 (ggtc) D186A03 (ggtc) P125H06 (ggtc) D146F03 (ggtc)
E123E04 (ggtc) W083B07 (ggtc) D165F04 (ggtc) P125H06 (ggtc) D007C07 (ggtc)
W245C02 (ggtc) E042A04 (ggtc) W024E11 (ggtc) P125H10 (ggtc) D146G03 (ggtc)
(cmhd) PST15205-NR (escells) PST10974-NL (escells) PST10347-NR (escells)
PST12547-NL (escells) PST13486-NL (escells) PST11687-NR (escells) PST10974-NR (escells)
PST11184-NR (escells) PST700-1 (escells) PST7892-NR (escells) PST2617-NR (escells)
PST4240-NR (escells) PST15032-NR (escells) PST3239-NL (escells) PST6737-NR (escells)
PST14034-NR (escells) PST13858-NL (escells) PST11571-NR (escells) PST11272-NR (escells)
PST4187-NR (escells) PST7420-NL (escells) PST4371-NR (escells) PST3325-NL (escells)
PST24002-NR (escells) PST15418-NR (escells) PST14845-NR (escells) PST1214-1 (escells)
PST14284-NL (escells) PST13645-NR (escells) PST11990-NR (escells) PST11428-NR (escells)
PST11011-NR (escells) PST4487-NR (escells) PST8666-NR (escells) PST2051-NR (escells)
PST3127-NL (escells) PST17344-NR (escells) PST15059-NR (escells) PST9071-NL (escells)
PST11305-NR (escells) PST14166-NL (escells) PST13279-NR (escells) PST11598-NR (escells)
PST10383-NR (escells) PST10864-NR (escells) PST841-2 (escells) PST6575-NR (escells)
PST2509-NR (escells) PST5282-NL (escells) PST15032-NL (escells) PST4487-NL (escells)
PST14749-NL (escells) PST14029-NR (escells) PST12314-NL (escells) PST11463-NR (escells)
PST11049-NR (escells) PST2340-NR (escells) PST8925-NR (escells) PST6445-NR (escells)
PST4492-NL (escells) PST22685-NR (escells) PST15274-NR (escells) PST12531-NR (escells)
PST30-1 (escells) PST12548-NL (escells) PST13493-NL (escells) PST11874-NR (escells)
PST9991-NL (escells) PST10182-NR (escells) PST1656-1 (escells) PST8034-NR (escells)
PST2019-NR (escells) PST2714-NR (escells) PST15048-NR (escells) PST4187-NL (escells)
PST10833-NR (escells) PST14165-NR (escells) PST13229-NR (escells) PST11593-NR (escells)
PST10284-NL (escells) PST10756-NR (escells) PST8026-NL (escells) PST8951-NR (escells)
PST2410-NR (escells) PST5891-NL (escells) PST24986-NR (escells) PST14982-NL (escells)
PST1235-2 (escells) PST14344-NR (escells) PST13883-NR (escells) PST12264-NR (escells)
PST11430-NR (escells) PST10546-NR (escells) PST3239-NR (escells) PST8906-NR (escells)
PST3885-NR (escells) PST4579-NR (escells) PST18318-NR (escells) PSTVU01.E69R (vanderbilt)
PSTVU01.MR12U (vanderbilt) IST11714F6 (tigm) IST10727F6 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 1% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000273294 (Chr10:127473545..127473616 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACAGAAACCGTCCCTGCTAC Chr10:127473562..127473581 59.21 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000273294 (Chr10:127473545..127473616 +)
Downstram Exon
ENSMUSE00000573195 (Chr10:127476227..127482142 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACAGAAACCGTCCCTGCTAC Chr10:127473562..127473581 59.21 55 GCCTCTTTTGGAGCTGTTTG Chr10:127481174..127481193 59.99 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000485964 Chr10:127472701..127472739 ATCTTGGTTCCGTGATCTCC Chr10:127472715..127472734 58.94 50
upstream ENSMUSE00000273294 Chr10:127473545..127473616 ACAGAAACCGTCCCTGCTAC Chr10:127473562..127473581 59.21 55

*** Putative Vector Insertion (Chr 10: 127473617 - 127476226) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000573195 Chr10:127476227..127482142 GCCTCTTTTGGAGCTGTTTG Chr10:127481174..127481193 59.99 50
downstream ENSMUSE00000481992 Chr10:127483224..127483309 CTTGTTCCTCGAGCTCTGGT Chr10:127483280..127483299 59.6 55
downstream ENSMUSE00000476151 Chr10:127483785..127483862 CTTCGACTCTGCTTGGCTTT Chr10:127483846..127483865 59.76 50
downstream ENSMUSE00000477920 Chr10:127484714..127484860 CCCCTGTAACCTGTCGAAGA Chr10:127484753..127484772 60.1 55
downstream ENSMUSE00000505712 Chr10:127485055..127485183 ACTCTCCTCTTGGACGGTTG Chr10:127485174..127485193 59.3 55
downstream ENSMUSE00000509865 Chr10:127485301..127485423 ACTTCCACACCCGTCTCATC Chr10:127485326..127485345 59.97 55
downstream ENSMUSE00000335588 Chr10:127485549..127485688 GAAAGGGGGAGTTGTCTTCG Chr10:127485597..127485616 60.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AACCACGTGACTGGGAAAAC Chr10:127473663..127473683 59.87 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000061315