Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI5820
Trapped Gene
Alkbh8 (ENSMUSG00000025899)
Vector Insertion
Chr 9: 3344720 - 3345780
Public Clones CSH611 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 25% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000457045 (Chr9:3344588..3344719 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAGGCCTCTTGGTGGTAGAA Chr9:3344624..3344643 60.25 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000457045 (Chr9:3344588..3344719 +)
Downstram Exon
ENSMUSE00000457040 (Chr9:3345781..3345876 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAGGCCTCTTGGTGGTAGAA Chr9:3344624..3344643 60.25 55 CCCAGGTAAGGGCTTGTCTT Chr9:3345878..3345897 60.49 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000384764 Chr9:3335478..3335594 CAGCTGGGAGGTGAACATTT Chr9:3335572..3335591 60.11 50
upstream ENSMUSE00000153944 Chr9:3338456..3338591 AAGGCATCCAAGCAGTGTCT Chr9:3338560..3338579 59.87 50
upstream ENSMUSE00000153943 Chr9:3343015..3343252 GTCTGGGTAATGGCGTGAGT Chr9:3343037..3343056 60 55
upstream ENSMUSE00000457045 Chr9:3344588..3344719 CAGGCCTCTTGGTGGTAGAA Chr9:3344624..3344643 60.25 55

*** Putative Vector Insertion (Chr 9: 3344720 - 3345780) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000457040 Chr9:3345781..3345876 CCCAGGTAAGGGCTTGTCTT Chr9:3345878..3345897 60.49 55
downstream ENSMUSE00000457035 Chr9:3347804..3347908 TGCTACTGCAAACCTCAGGA Chr9:3347830..3347849 59.59 50
downstream ENSMUSE00000457033 Chr9:3349420..3349490 AAATGCAGAATGCGTGTCAA Chr9:3349457..3349476 60.26 40
downstream ENSMUSE00000457027 Chr9:3359484..3359590 AGCAAACTCCGACGAGGTAA Chr9:3359554..3359573 59.88 50
downstream ENSMUSE00000457025 Chr9:3367864..3368015 CTCAGACGCTTGGACGGTAT Chr9:3367906..3367925 60.28 55
downstream ENSMUSE00000153963 Chr9:3369658..3369914 TTGTCTGTCGCAGACTGAGG Chr9:3369686..3369705 60.18 55
downstream ENSMUSE00000340659 Chr9:3382694..3382843 TGGTGAATGACGGCAATAGA Chr9:3382833..3382852 60.07 45
downstream ENSMUSE00000378203 Chr9:3385042..3387050 TGTTCCATTGCCCAGACATA Chr9:3385130..3385149 59.92 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000025899