Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI5827
Trapped Gene
Prdm4 (ENSMUSG00000035529)
Vector Insertion
Chr 10: 85370816 - 85372967
Public Clones CSH728 (baygenomics) CSH454 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 13% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000375114 (Chr10:85372968..85373153 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGCCTTCTGCCTTGTCTCTT Chr10:85373089..85373108 60.13 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000375114 (Chr10:85372968..85373153 -)
Downstram Exon
ENSMUSE00000251595 (Chr10:85370021..85370815 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGCCTTCTGCCTTGTCTCTT Chr10:85373089..85373108 60.13 50 ATTCCCGTGAATGGGTATCA Chr10:85370345..85370364 60.01 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000574395 Chr10:85379553..85379690 GGCGGGAAATGTTAGGAGAG Chr10:85379658..85379677 60.95 55
upstream ENSMUSE00000574394 Chr10:85379269..85379474 No primer for this exon
upstream ENSMUSE00000446807 Chr10:85375583..85375716 GGAGCAGCTGTCTTCATCCT Chr10:85375664..85375683 59.56 55
upstream ENSMUSE00000375114 Chr10:85372968..85373153 TGCCTTCTGCCTTGTCTCTT Chr10:85373089..85373108 60.13 50

*** Putative Vector Insertion (Chr 10: 85370816 - 85372967) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000251595 Chr10:85370021..85370815 ATTCCCGTGAATGGGTATCA Chr10:85370345..85370364 60.01 45
downstream ENSMUSE00000251589 Chr10:85368094..85368243 GGTAGGCTCGGTCACAAAGA Chr10:85368195..85368214 60.26 55
downstream ENSMUSE00000405731 Chr10:85366876..85367015 CCAATTAGAGGTCCGAAGCA Chr10:85366918..85366937 60.21 50
downstream ENSMUSE00000251570 Chr10:85365672..85365757 CTTTGCGCACAAACATCATC Chr10:85365654..85365673 60.26 45
downstream ENSMUSE00000251562 Chr10:85364449..85364576 GGGATAGGCCACCAAATTCT Chr10:85364521..85364540 60.15 50
downstream ENSMUSE00000251551 Chr10:85363587..85363901 GGTGTGTCCGTAGGTTGCTT Chr10:85363580..85363599 60.03 55
downstream ENSMUSE00000251543 Chr10:85361920..85362088 GAGCCTTCTGCGTGAAAGAC Chr10:85362013..85362032 60.14 55
downstream ENSMUSE00000355587 Chr10:85354715..85356184 ATGTGCGGAGAGAGACTCGT Chr10:85355859..85355878 60.02 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAATCGCCTTGCAGCACAT Chr10:85372897..85372917 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCTTACCCTCACCTAGAGAGCA Chr10:85372990..85373012 59.9 54.54 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000035529