Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI5839
Trapped Gene
D130003B22Rik (ENSMUSG00000024459)
Vector Insertion
Chr 17: 37124469 - 37124599
Public Clones CSH934 (baygenomics) M064B08 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 88% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000696606 (Chr17:37124600..37124875 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGCATCTGTGGTGGTACCTT Chr17:37124672..37124691 59.85 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000696606 (Chr17:37124600..37124875 -)
Downstram Exon
ENSMUSE00000696604 (Chr17:37124361..37124468 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGCATCTGTGGTGGTACCTT Chr17:37124672..37124691 59.85 55 GAAGCAGGCCAACAGTGATT Chr17:37124396..37124415 60.26 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000696612 Chr17:37126374..37126449 CTGCGCTCTCTACCCTCCTA Chr17:37126420..37126439 59.73 60
upstream ENSMUSE00000696611 Chr17:37125880..37126149 TTCGTGGACGACACACAGTT Chr17:37126053..37126072 60.2 50
upstream ENSMUSE00000696609 Chr17:37125450..37125725 CTCCGCACATACCTGGAGAT Chr17:37125476..37125495 60.1 55
upstream ENSMUSE00000696606 Chr17:37124600..37124875 GGCATCTGTGGTGGTACCTT Chr17:37124672..37124691 59.85 55

*** Putative Vector Insertion (Chr 17: 37124469 - 37124599) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000696604 Chr17:37124361..37124468 GAAGCAGGCCAACAGTGATT Chr17:37124396..37124415 60.26 50
downstream ENSMUSE00000696602 Chr17:37121006..37122047 GAACAAGCATGTGGGAGGTT Chr17:37121169..37121188 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTGCAACATGAGGGGCTAAC Chr17:37124621..37124641 60.53 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTGCAACATGAGGGGCTAAC Chr17:37124621..37124641 60.53 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024459