Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI5870
Trapped Gene
Cdk7 (ENSMUSG00000069089)
Vector Insertion
Chr 13: 101492669 - 101500412
Public Clones (sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
CSH028 (baygenomics) E030E03 (ggtc) D032B11 (ggtc) P063E02 (ggtc)
D096H02 (ggtc) E065F09 (ggtc) D063A10 (ggtc) D063A10 (ggtc) D108A04 (ggtc)
D032B11 (ggtc) E088C05 (ggtc) D093A07 (ggtc) E057G05 (ggtc) D063A10 (ggtc)
D032B11 (ggtc) D096H02 (ggtc) E065F09 (ggtc) D091C02 (ggtc) (cmhd)
PST20408-NR (escells) PST17418-NR (escells) PST22262-NR (escells) PST17558-NL (escells)
PST16289-NL (escells) PST21619-NR (escells) PST17497-NL (escells) IST14560G6 (tigm)
IST15004F6 (tigm) IST10132C5 (tigm) IST11469A7 (tigm) IST14546B4 (tigm)
IST14570D5 (tigm) IST11562E1 (tigm) IST10921B9 (tigm) IST13443E4 (tigm)
IST14457A10 (tigm) IST13202E3 (tigm) IST14617C2 (tigm)
Private Clones OST453605 (lexicon) OST448168 (lexicon) OST433447 (lexicon) OST395362 (lexicon)
OST394002 (lexicon) OST373847 (lexicon) OST369549 (lexicon) OST356459 (lexicon)
OST329536 (lexicon) OST324512 (lexicon) OST320433 (lexicon) OST315943 (lexicon)
OST314668 (lexicon) OST275921 (lexicon) OST275467 (lexicon) OST271019 (lexicon)
OST267142 (lexicon) OST263961 (lexicon) OST263525 (lexicon) OST252861 (lexicon)
OST252807 (lexicon) OST208362 (lexicon) OST197487 (lexicon) OST194870 (lexicon)
OST194427 (lexicon) OST188213 (lexicon) OST154942 (lexicon) OST149805 (lexicon)
OST131511 (lexicon) OST114870 (lexicon) OST67703 (lexicon) OST60882 (lexicon)
OST36361 (lexicon)
Severity of mutation (?) Insertion after 12% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000569293 (Chr13:101500413..101500472 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACCAAATCGTCGCCATTAAG Chr13:101500416..101500435 59.96 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000569293 (Chr13:101500413..101500472 -)
Downstram Exon
ENSMUSE00000569289 (Chr13:101492635..101492668 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACCAAATCGTCGCCATTAAG Chr13:101500416..101500435 59.96 45 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000569295 Chr13:101500729..101500878 TCGGACGCTTTAAATTCCTG Chr13:101500843..101500862 60.2 45
upstream ENSMUSE00000569293 Chr13:101500413..101500472 ACCAAATCGTCGCCATTAAG Chr13:101500416..101500435 59.96 45

*** Putative Vector Insertion (Chr 13: 101492669 - 101500412) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000569289 Chr13:101492635..101492668 No primer for this exon
downstream ENSMUSE00000569288 Chr13:101490541..101490608 No primer for this exon
downstream ENSMUSE00000569286 Chr13:101489257..101489325 TGTCCAAATGCATCAAGGAG Chr13:101489284..101489303 59.65 45
downstream ENSMUSE00000569283 Chr13:101487527..101487637 TCAGCACAAGGCTGTTATCCT Chr13:101487585..101487605 59.89 47.62
downstream ENSMUSE00000569281 Chr13:101486456..101486574 GCCAAAATCTGCCAGTTTCA Chr13:101486490..101486509 61.15 45
downstream ENSMUSE00000569278 Chr13:101481452..101481551 CCCACATGTCTACTCCCACA Chr13:101481465..101481484 59.39 55
downstream ENSMUSE00000569276 Chr13:101480029..101480115 TCTCCAGGCAAAAATGGAAC Chr13:101480074..101480093 60.05 45
downstream ENSMUSE00000569275 Chr13:101476322..101476471 AAGAACAGGCCTTGGATGAG Chr13:101476334..101476353 59.28 50
downstream ENSMUSE00000569272 Chr13:101474346..101474493 TCTGCTCTTTTCCGCTTTGT Chr13:101474338..101474357 60.13 45
downstream ENSMUSE00000640048 Chr13:101473270..101473461 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTGCGTCTTGCTTGTAATCG Chr13:101494355..101494375 60.01 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGGTTTTCTTGCTTGCTTTTA Chr13:101494439..101494461 61.07 36.36 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CAGGGACAAGAACACCAACC Chr13:101494431..101494451 60.4 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CAGGGACAAGAACACCAACC Chr13:101494431..101494451 60.4 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000069089