Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI5891
Trapped Gene
Ifrd2 (ENSMUSG00000010048)
Vector Insertion
Chr 9: 107490278 - 107492233
Public Clones YHD416 (baygenomics) (ggtc) D067A02 (ggtc) (ggtc) D067A02 (ggtc)
IST14854E5 (tigm) IST14977F4 (tigm) IST14677B2 (tigm)
Private Clones OST252729 (lexicon)
Severity of mutation (?) Insertion after 4% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000221084 (Chr9:107490049..107490277 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000221084 (Chr9:107490049..107490277 +)
Downstram Exon
ENSMUSE00000221081 (Chr9:107492234..107492353 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000221084 Chr9:107490049..107490277 No primer for this exon

*** Putative Vector Insertion (Chr 9: 107490278 - 107492233) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000221081 Chr9:107492234..107492353 No primer for this exon
downstream ENSMUSE00000221086 Chr9:107492440..107492524 No primer for this exon
downstream ENSMUSE00000221077 Chr9:107492629..107492753 No primer for this exon
downstream ENSMUSE00000221078 Chr9:107492836..107492993 No primer for this exon
downstream ENSMUSE00000221083 Chr9:107493127..107493177 No primer for this exon
downstream ENSMUSE00000221085 Chr9:107493263..107493441 No primer for this exon
downstream ENSMUSE00000221080 Chr9:107493533..107493638 No primer for this exon
downstream ENSMUSE00000221082 Chr9:107493899..107494036 No primer for this exon
downstream ENSMUSE00000221079 Chr9:107494406..107494534 No primer for this exon
downstream ENSMUSE00000221088 Chr9:107494607..107494702 No primer for this exon
downstream ENSMUSE00000221087 Chr9:107494806..107495369 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTGAGCGGGGGTGTTCTAAT Chr9:107490313..107490333 61.27 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000010048