Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI5904
Trapped Gene
Trak1 (ENSMUSG00000032536)
Vector Insertion
Chr 9: 121369696 - 121378102
Public Clones CSH100 (baygenomics) P062G06 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 70% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000582958 (Chr9:121369477..121369695 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTAGCTACCTCCACGCCAAT Chr9:121369656..121369675 59.36 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000582958 (Chr9:121369477..121369695 +)
Downstram Exon
ENSMUSE00000582957 (Chr9:121378103..121378205 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTAGCTACCTCCACGCCAAT Chr9:121369656..121369675 59.36 55 CGGCAAGTGGTAAAGGTGAA Chr9:121378166..121378185 61.05 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000633538 Chr9:121206620..121206951 CTACGCTGAGCCTCGCAGTC Chr9:121206831..121206850 63.67 65
upstream ENSMUSE00000633537 Chr9:121273119..121273417 GGAAGATGCTCCCAGCTACA Chr9:121273368..121273387 60.36 55
upstream ENSMUSE00000259358 Chr9:121276076..121276309 AAGCTTGGGAAAACTGCTGA Chr9:121276124..121276143 59.99 45
upstream ENSMUSE00000528168 Chr9:121300975..121301169 AACAGCTGCCCCATTACAAG Chr9:121301029..121301048 60.13 50
upstream ENSMUSE00000633536 Chr9:121300975..121301169 AACAGCTGCCCCATTACAAG Chr9:121301029..121301048 60.13 50
upstream ENSMUSE00000520674 Chr9:121340597..121340673 TGACATTGATGCTGTCACGA Chr9:121340640..121340659 59.82 45
upstream ENSMUSE00000220555 Chr9:121349788..121349904 GAAGAGCAGGTGGAGCACAT Chr9:121349875..121349894 60.42 55
upstream ENSMUSE00000220546 Chr9:121351810..121351910 TGAAAGACGAGCTGCTTCAA Chr9:121351838..121351857 59.86 45
upstream ENSMUSE00000497415 Chr9:121352744..121352852 TCAAGGACCTCGAAGAGGAG Chr9:121352812..121352831 59.53 55
upstream ENSMUSE00000501964 Chr9:121354933..121355011 ATGAGGAGAAGGAGCAGCAG Chr9:121354964..121354983 59.7 55
upstream ENSMUSE00000499273 Chr9:121355808..121355938 TCGCAAATCGTGGACTTACA Chr9:121355903..121355922 60.26 45
upstream ENSMUSE00000510957 Chr9:121357226..121357300 AATGAAGAGCTTGTCCAGCA Chr9:121357238..121357257 58.6 45
upstream ENSMUSE00000508239 Chr9:121357940..121358071 GAAGAACCTGCGGAACAAGA Chr9:121358005..121358024 60.38 50
upstream ENSMUSE00000512812 Chr9:121360769..121360845 CTGCAGAAATCGAGGGAACT Chr9:121360779..121360798 59.43 50
upstream ENSMUSE00000507389 Chr9:121362326..121362562 TCTTCGAGACGGTGAGGAAC Chr9:121362340..121362359 60.39 55
upstream ENSMUSE00000528159 Chr9:121363397..121363713 GACCTGGAGACGGCACTTAG Chr9:121363449..121363468 59.87 60
upstream ENSMUSE00000633530 Chr9:121363397..121363862 GACCTGGAGACGGCACTTAG Chr9:121363449..121363468 59.87 60
upstream ENSMUSE00000582958 Chr9:121369477..121369695 CTAGCTACCTCCACGCCAAT Chr9:121369656..121369675 59.36 55

*** Putative Vector Insertion (Chr 9: 121369696 - 121378102) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000582957 Chr9:121378103..121378205 CGGCAAGTGGTAAAGGTGAA Chr9:121378166..121378185 61.05 50
downstream ENSMUSE00000582956 Chr9:121381355..121384034 CATGGTTGTCGTGGACTCAC Chr9:121381493..121381512 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCACCTGGTTAAGACAGGCTA Chr9:121372663..121372684 59.25 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCACCTGGTTAAGACAGGCTA Chr9:121372663..121372684 59.25 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032536