Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI5915
Trapped Gene
D430028G21Rik (ENSMUSG00000037523)
Vector Insertion
Chr 2: 131069009 - 131070938
Public Clones CSH141 (baygenomics) PST4480-NL (escells) PST4352-NL (escells) PST4352-NR (escells)
Private Clones not available
Severity of mutation (?) Insertion after 41% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000255101 (Chr2:131068855..131069008 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGAGCAACTCCTCCAGACCA Chr2:131068860..131068879 59.99 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000255101 (Chr2:131068855..131069008 +)
Downstram Exon
ENSMUSE00000255095 (Chr2:131070939..131071405 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGAGCAACTCCTCCAGACCA Chr2:131068860..131068879 59.99 55 GGTAATTTTGATGGCGCTGT Chr2:131071302..131071321 59.97 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000596279 Chr2:131059803..131059863 CGGTCAACCTGTTGCCTAGT Chr2:131059831..131059850 60.17 55
upstream ENSMUSE00000683105 Chr2:131059841..131060091 ATCCAGCACCTTTAGCAAGC Chr2:131060070..131060089 59.48 50
upstream ENSMUSE00000255128 Chr2:131064472..131064646 TATCCGAGACAACCACAGCA Chr2:131064562..131064581 60.26 50
upstream ENSMUSE00000721821 Chr2:131064472..131064646 TATCCGAGACAACCACAGCA Chr2:131064562..131064581 60.26 50
upstream ENSMUSE00000255119 Chr2:131066051..131066228 GGACACACTCTGGGGACTCT Chr2:131066089..131066108 59.12 60
upstream ENSMUSE00000255110 Chr2:131067616..131067785 TGGCTTACGAGAGACACCAA Chr2:131067716..131067735 59.44 50
upstream ENSMUSE00000255101 Chr2:131068855..131069008 AGAGCAACTCCTCCAGACCA Chr2:131068860..131068879 59.99 55

*** Putative Vector Insertion (Chr 2: 131069009 - 131070938) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000255095 Chr2:131070939..131071405 GGTAATTTTGATGGCGCTGT Chr2:131071302..131071321 59.97 45
downstream ENSMUSE00000355802 Chr2:131072100..131073761 CCTCCAGTGGTGACTTTGGT Chr2:131072143..131072162 60 55
downstream ENSMUSE00000683086 Chr2:131072100..131073756 CCTCCAGTGGTGACTTTGGT Chr2:131072143..131072162 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGTAATCGCCTTGCAGCAC Chr2:131069057..131069077 60.42 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGCATCAAGAGCAAGAACCA Chr2:131068964..131068985 60.53 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037523