Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI5920
Trapped Gene
Pcmt1 (ENSMUSG00000019795)
Vector Insertion
Chr 10: 7368954 - 7382872
Public Clones (sanger) (sanger) CSH154 (baygenomics) W238F08 (ggtc) IST12384E1 (tigm)
IST11626C8 (tigm) IST12838A9 (tigm) IST12180C6 (tigm)
Private Clones OST427868 (lexicon) OST327050 (lexicon) OST276124 (lexicon) OST202756 (lexicon)
OST188944 (lexicon) OST168899 (lexicon) OST67309 (lexicon) OST47444 (lexicon)
OST42846 (lexicon) OST39087 (lexicon) OST37754 (lexicon) OST34068 (lexicon)
OST31050 (lexicon)
Severity of mutation (?) Insertion after 8% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000616530 (Chr10:7382873..7383048 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000616530 (Chr10:7382873..7383048 -)
Downstram Exon
ENSMUSE00000323238 (Chr10:7368849..7368953 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000616530 Chr10:7382873..7383048 No primer for this exon

*** Putative Vector Insertion (Chr 10: 7368954 - 7382872) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000323238 Chr10:7368849..7368953 No primer for this exon
downstream ENSMUSE00000644988 Chr10:7367388..7367419 No primer for this exon
downstream ENSMUSE00000644987 Chr10:7364123..7364227 No primer for this exon
downstream ENSMUSE00000644986 Chr10:7360493..7360613 No primer for this exon
downstream ENSMUSE00000644985 Chr10:7359843..7359928 No primer for this exon
downstream ENSMUSE00000666804 Chr10:7357848..7358023 No primer for this exon
downstream ENSMUSE00000355412 Chr10:7357807..7358023 No primer for this exon
downstream ENSMUSE00000666802 Chr10:7357741..7357744 No primer for this exon
downstream ENSMUSE00000616525 Chr10:7349986..7350774 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr10:7382802..7382822 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCGGAGCTAATCCACAACCT Chr10:7382876..7382896 59.69 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CCTCCAGAATGAAGGGCTTT Chr10:7383061..7383081 60.57 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GGAAGTCGTGACTGGGAAAA Chr10:7382984..7383004 60.09 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000019795