Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI5930
Trapped Gene
Brd9 (ENSMUSG00000057649)
Vector Insertion
Chr 13: 74076446 - 74077684
Public Clones CSH204 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 22% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000449606 (Chr13:74076313..74076445 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGAAACGGAAACGGGAGAAG Chr13:74076320..74076339 60.6 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000449606 (Chr13:74076313..74076445 +)
Downstram Exon
ENSMUSE00000515491 (Chr13:74077685..74077745 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGAAACGGAAACGGGAGAAG Chr13:74076320..74076339 60.6 50 GCCTCTGGATAGGTGTGCTC Chr13:74077717..74077736 59.83 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000449615 Chr13:74075286..74075393 ATGGGCAAAAAGCACAAGAA Chr13:74075342..74075361 60.62 40
upstream ENSMUSE00000449611 Chr13:74075882..74076096 AAGGAGAAGCACCTCGATGA Chr13:74076055..74076074 59.95 50
upstream ENSMUSE00000449606 Chr13:74076313..74076445 AGAAACGGAAACGGGAGAAG Chr13:74076320..74076339 60.6 50

*** Putative Vector Insertion (Chr 13: 74076446 - 74077684) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000515491 Chr13:74077685..74077745 GCCTCTGGATAGGTGTGCTC Chr13:74077717..74077736 59.83 60
downstream ENSMUSE00000570270 Chr13:74078094..74078238 TCATCGTGCCAAAGTCCATA Chr13:74078194..74078213 60.07 45
downstream ENSMUSE00000570269 Chr13:74079392..74079502 CGTCATCGCATTATCACACA Chr13:74079430..74079449 59.1 45
downstream ENSMUSE00000570268 Chr13:74080139..74080254 ACTTGCACTGGGACAACCTC Chr13:74080212..74080231 60.16 55
downstream ENSMUSE00000570267 Chr13:74082174..74082306 TCATCAGCTGCGTGCTCTAC Chr13:74082269..74082288 60.32 55
downstream ENSMUSE00000641204 Chr13:74083532..74083607 GCAGACTTCCATCTCCAAGC Chr13:74083571..74083590 59.96 55
downstream ENSMUSE00000641203 Chr13:74085125..74085220 AGGTCCACAGGGTGTGTCTC Chr13:74085152..74085171 60.01 60
downstream ENSMUSE00000641202 Chr13:74087523..74087655 TGCACACCAGTCTCATCTCC Chr13:74087646..74087665 59.83 55
downstream ENSMUSE00000641201 Chr13:74088982..74089093 TGTGATTTGGTCCAGGAGGT Chr13:74089057..74089076 60.36 50
downstream ENSMUSE00000641200 Chr13:74091993..74092031 No primer for this exon
downstream ENSMUSE00000641199 Chr13:74092870..74092972 CTGAGCATGGACACATCCAG Chr13:74092967..74092986 60.27 55
downstream ENSMUSE00000641198 Chr13:74095161..74095328 TTCATGGTCCAGCTCCTTCT Chr13:74095192..74095211 59.8 50
downstream ENSMUSE00000483494 Chr13:74097686..74098342 GGACACCATTCGGTGCTACT Chr13:74097965..74097984 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCCCCAAACATGAGTTTCCT Chr13:74076458..74076478 59.38 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCCCCAAACATGAGTTTCCT Chr13:74076458..74076478 59.38 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000057649