Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI5949
Trapped Gene
Osgin2 (ENSMUSG00000041153)
Vector Insertion
Chr 4: 15935903 - 15940833
Public Clones CSH275 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 3% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000416496 (Chr4:15940834..15941024 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000416496 (Chr4:15940834..15941024 -)
Downstram Exon
ENSMUSE00000251147 (Chr4:15935748..15935902 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CCCCAAATTGTCACCAAAAT Chr4:15935808..15935827 59.52 40

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000416496 Chr4:15940834..15941024 No primer for this exon

*** Putative Vector Insertion (Chr 4: 15935903 - 15940833) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000251147 Chr4:15935748..15935902 CCCCAAATTGTCACCAAAAT Chr4:15935808..15935827 59.52 40
downstream ENSMUSE00000177377 Chr4:15933504..15933640 TGCTTCCGATGATAAATACGG Chr4:15933548..15933568 59.94 42.86
downstream ENSMUSE00000177372 Chr4:15932504..15932695 GGGTGAAGAAGGGTGTCAAA Chr4:15932594..15932613 59.94 50
downstream ENSMUSE00000416470 Chr4:15929077..15929168 AAGCTCCATCCAATTTCCAA Chr4:15929096..15929115 59.51 40
downstream ENSMUSE00000251192 Chr4:15924268..15926147 CACGCATAACCCTTGGAGAT Chr4:15924693..15924712 59.96 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CGGTCATTTCAGGTGACTTTC Chr4:15940823..15940844 59.58 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CGGTCATTTCAGGTGACTTTC Chr4:15940823..15940844 59.58 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000041153