Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI5965
Trapped Gene
Itpa (ENSMUSG00000074797)
Vector Insertion
Chr 2: 130493672 - 130497136
Public Clones (sanger) XI446 (baygenomics) CSH341 (baygenomics) IST14801D1 (tigm)
IST14558F10 (tigm) IST14991D7 (tigm) IST14495A6 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 11% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000641073 (Chr2:130493565..130493671 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000641073 (Chr2:130493565..130493671 +)
Downstram Exon
ENSMUSE00000641072 (Chr2:130497137..130497194 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TCTGAGCCTCCAAAGTGCAT Chr2:130497188..130497207 60.94 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000641073 Chr2:130493565..130493671 No primer for this exon

*** Putative Vector Insertion (Chr 2: 130493672 - 130497136) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000641072 Chr2:130497137..130497194 TCTGAGCCTCCAAAGTGCAT Chr2:130497188..130497207 60.94 50
downstream ENSMUSE00000641071 Chr2:130497292..130497356 ATCCGGTTCTCCCTGGTACT Chr2:130497320..130497339 59.82 55
downstream ENSMUSE00000641070 Chr2:130497796..130497869 CAGGTATCTTCCACCAGGACA Chr2:130497829..130497849 59.97 52.38
downstream ENSMUSE00000641069 Chr2:130499975..130500006 TCAGGCTTCAGCTTCTGTAGG Chr2:130500006..130500026 59.77 52.38
downstream ENSMUSE00000661550 Chr2:130501365..130501480 GAGTGCATAGGCCGATTTGT Chr2:130501417..130501436 60.1 50
downstream ENSMUSE00000661549 Chr2:130505071..130505147 TCGTGGCATCACAATCTGTC Chr2:130505094..130505113 60.7 50
downstream ENSMUSE00000661548 Chr2:130506709..130507349 TCTTTGCCAAACCTTCAACC Chr2:130507273..130507292 60.09 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTGGTGATTGGGCTGCTAAT Chr2:130493707..130493727 59.96 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCTACCGTGACTGGGAAAAC Chr2:130493718..130493738 59.6 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000074797