Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI5972
Trapped Gene
St5 (ENSMUSG00000031024)
Vector Insertion
Chr 7: 116683951 - 116684849
Public Clones CSH363 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 57% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000369167 (Chr7:116684850..116684946 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTCCAGCCTTGAGACAGCAT Chr7:116684859..116684878 60.42 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000369167 (Chr7:116684850..116684946 -)
Downstram Exon
ENSMUSE00000404874 (Chr7:116683906..116683950 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTCCAGCCTTGAGACAGCAT Chr7:116684859..116684878 60.42 55 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000466750 Chr7:116760572..116760661 CAAGAGACTGCTTGGGCTCT Chr7:116760637..116760656 59.74 55
upstream ENSMUSE00000514123 Chr7:116759812..116760082 GCAAGAAATCACCCGGACTA Chr7:116759816..116759835 60.07 50
upstream ENSMUSE00000359869 Chr7:116713521..116713625 AGAGCCGAAATGACCATGAC Chr7:116713590..116713609 60.08 50
upstream ENSMUSE00000384284 Chr7:116699725..116700975 CATAGCCTGGGTATCCGAGA Chr7:116700568..116700587 60.05 55
upstream ENSMUSE00000277150 Chr7:116696489..116696625 TCCTTCGAGTTTGAGGATGC Chr7:116696602..116696621 60.34 50
upstream ENSMUSE00000277144 Chr7:116688591..116688742 TGGACTCTTTGCACAGGATG Chr7:116688633..116688652 59.83 50
upstream ENSMUSE00000277141 Chr7:116685834..116686049 ACATGATGCTGTTGGCTCAG Chr7:116685930..116685949 59.86 50
upstream ENSMUSE00000369167 Chr7:116684850..116684946 GTCCAGCCTTGAGACAGCAT Chr7:116684859..116684878 60.42 55

*** Putative Vector Insertion (Chr 7: 116683951 - 116684849) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000404874 Chr7:116683906..116683950 No primer for this exon
downstream ENSMUSE00000376492 Chr7:116683176..116683360 TGTTCCGAGATGGCTTCTTC Chr7:116683189..116683208 60.34 50
downstream ENSMUSE00000205638 Chr7:116682448..116682557 AAGCAAAACTGGGGGATAGC Chr7:116682468..116682487 60.45 50
downstream ENSMUSE00000205635 Chr7:116681790..116681859 AAGCGCCTACAATAGCCAAA Chr7:116681772..116681791 59.88 45
downstream ENSMUSE00000205633 Chr7:116678808..116678885 AAACAAACCGAAGCAGCCTA Chr7:116678792..116678811 59.88 45
downstream ENSMUSE00000205640 Chr7:116678148..116678288 CGCTCCACCTCATCTAGGAC Chr7:116678247..116678266 59.83 60
downstream ENSMUSE00000528082 Chr7:116674596..116674744 TAAGCTGACGCACACTGAGG Chr7:116674635..116674654 60.2 55
downstream ENSMUSE00000205632 Chr7:116671128..116671305 GGGACAGCAGACAATGTCAA Chr7:116671172..116671191 59.68 50
downstream ENSMUSE00000205631 Chr7:116670858..116670899 CGGTCAGATCCCAGATTCAC Chr7:116670849..116670868 60.47 55
downstream ENSMUSE00000205629 Chr7:116669740..116669851 AGTGTGTCCTCGTCGTCCAT Chr7:116669810..116669829 60.6 55
downstream ENSMUSE00000205637 Chr7:116669053..116669292 TTCAAGAAAACGGCGGATAC Chr7:116669101..116669120 60.07 45
downstream ENSMUSE00000205639 Chr7:116668777..116668863 AACTTGTTCATCCCGCTCTG Chr7:116668769..116668788 60.26 50
downstream ENSMUSE00000506992 Chr7:116667434..116668194 GCAAGACTCCATCCAAGCTC Chr7:116667864..116667883 59.96 55
downstream ENSMUSE00000333624 Chr7:116667425..116668194 GCAAGACTCCATCCAAGCTC Chr7:116667864..116667883 59.96 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000031024