Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI5983
Trapped Gene
Rrp12 (ENSMUSG00000035049)
Vector Insertion
Chr 19: 41948832 - 41949018
Public Clones CSH398 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 66% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000279236 (Chr19:41949019..41949099 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGAGTTCATAGCTGCCCTCA Chr19:41949027..41949046 60.36 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000279236 (Chr19:41949019..41949099 -)
Downstram Exon
ENSMUSE00000279214 (Chr19:41948726..41948831 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGAGTTCATAGCTGCCCTCA Chr19:41949027..41949046 60.36 55 ACCAGCAAGGTAAACGCACT Chr19:41948748..41948767 59.8 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000278925 Chr19:41970429..41970663 GTTGAAGCGCTGGAAGAAAG Chr19:41970507..41970526 60.13 50
upstream ENSMUSE00000279737 Chr19:41969638..41969867 GTGGCTTTCACCGAGAAGTC Chr19:41969735..41969754 59.85 55
upstream ENSMUSE00000279714 Chr19:41967028..41967111 ACGGAGACCGAGTACTTTGC Chr19:41967035..41967054 59.36 55
upstream ENSMUSE00000279689 Chr19:41965574..41965650 TGCCGTTGCATACCTATTGA Chr19:41965590..41965609 60.1 45
upstream ENSMUSE00000279669 Chr19:41964559..41964664 CCAAAGCCTTCATGGACATC Chr19:41964604..41964623 60.46 50
upstream ENSMUSE00000279649 Chr19:41964256..41964372 GGTGTACCATGGACTGCTGA Chr19:41964282..41964301 59.55 55
upstream ENSMUSE00000279638 Chr19:41961501..41961639 GCTCAGTTCTCAAGGGCAGT Chr19:41961592..41961611 59.6 55
upstream ENSMUSE00000279622 Chr19:41961290..41961417 CTGGTGAAGAGCTGCAGTGA Chr19:41961324..41961343 60.33 55
upstream ENSMUSE00000279597 Chr19:41960577..41960675 CACCCTGTCAGCAGAACTCA Chr19:41960594..41960613 60.02 55
upstream ENSMUSE00000279565 Chr19:41960137..41960228 CCTGGCTTAAGGTCATGGAG Chr19:41960160..41960179 59.69 55
upstream ENSMUSE00000279530 Chr19:41958203..41958314 CTTGCTCGATTTTTCGGAAC Chr19:41958267..41958286 59.82 45
upstream ENSMUSE00000279484 Chr19:41957913..41958010 CTCAGGTCCTCCCCAGTACA Chr19:41957929..41957948 60.1 60
upstream ENSMUSE00000279456 Chr19:41956649..41956763 TGGAAGAGGGCCTCACATAC Chr19:41956739..41956758 60.07 55
upstream ENSMUSE00000279432 Chr19:41954849..41954991 CTCCAGTCCCTGTGTGACCT Chr19:41954969..41954988 60.15 60
upstream ENSMUSE00000279407 Chr19:41954592..41954713 GATCATGTTCGGGAAACCAG Chr19:41954648..41954667 60.32 50
upstream ENSMUSE00000279386 Chr19:41952519..41952583 CAGCACAGTGGAGTCGAAGA Chr19:41952542..41952561 60.18 55
upstream ENSMUSE00000279351 Chr19:41952274..41952436 AGGCCCTACGTACCCTCATC Chr19:41952293..41952312 60.35 60
upstream ENSMUSE00000279317 Chr19:41951826..41951980 TCCTGCCAATCCTCTTCAAC Chr19:41951922..41951941 60.19 50
upstream ENSMUSE00000279301 Chr19:41951591..41951658 AAAAAGCCACCGAGAAGGTT Chr19:41951620..41951639 60.11 45
upstream ENSMUSE00000279281 Chr19:41951025..41951118 TTTGGCTCCTTACTCGGATG Chr19:41951072..41951091 60.21 50
upstream ENSMUSE00000279260 Chr19:41949207..41949365 AGAGCCACCTGGATGATCTG Chr19:41949258..41949277 60.22 55
upstream ENSMUSE00000279236 Chr19:41949019..41949099 GGAGTTCATAGCTGCCCTCA Chr19:41949027..41949046 60.36 55

*** Putative Vector Insertion (Chr 19: 41948832 - 41949018) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000279214 Chr19:41948726..41948831 ACCAGCAAGGTAAACGCACT Chr19:41948748..41948767 59.8 50
downstream ENSMUSE00000279198 Chr19:41948233..41948340 AGAGCCAAAATGCTGCAACT Chr19:41948237..41948256 60.02 45
downstream ENSMUSE00000279181 Chr19:41947399..41947556 CTTGACCACATCACGGGTTC Chr19:41947452..41947471 61.38 55
downstream ENSMUSE00000279163 Chr19:41946223..41946314 AACTTGCGGGTGAACTTGAT Chr19:41946204..41946223 59.6 45
downstream ENSMUSE00000279132 Chr19:41945912..41946079 TATTCTGCGGGTAGCAGACC Chr19:41946022..41946041 60.24 55
downstream ENSMUSE00000279093 Chr19:41945625..41945794 TTGGGATCCAGGAAGTTGAG Chr19:41945623..41945642 60.04 50
downstream ENSMUSE00000279069 Chr19:41945300..41945425 AAGCCATGGTCCCTCTTCTT Chr19:41945358..41945377 60.07 50
downstream ENSMUSE00000279051 Chr19:41943260..41943309 GCATCGGTCATGTCTTCATC Chr19:41943263..41943282 59.04 50
downstream ENSMUSE00000279030 Chr19:41941196..41941262 TCTGCCGCTTAAGCTTCTTT Chr19:41941219..41941238 59.38 45
downstream ENSMUSE00000279008 Chr19:41940011..41940078 GGCCTTGTATTCAGCTCCAG Chr19:41939992..41940011 59.84 55
downstream ENSMUSE00000278981 Chr19:41939662..41939744 AGTGGAACGTACGCATAGGG Chr19:41939664..41939683 60.01 55
downstream ENSMUSE00000278959 Chr19:41937346..41937802 CTGGACCACAGCAGAGAACA Chr19:41937635..41937654 60.02 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATTCCATAATCGCCTTGCAG Chr19:41948953..41948973 60.06 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATTCCACGTGACTGGGAAAA Chr19:41948953..41948973 60.35 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000035049