Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI6
Trapped Gene
Rfx7 (ENSMUSG00000037674)
Vector Insertion
Chr 9: 72459636 - 72462843
Public Clones GC0604 (tigem) GC0243 (tigem)
Private Clones not available
Severity of mutation (?) Insertion after 19% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000407498 (Chr9:72459428..72459635 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAAGTCAATGGCAGCTCTGA Chr9:72459592..72459611 60.14 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000407498 (Chr9:72459428..72459635 +)
Downstram Exon
ENSMUSE00000583988 (Chr9:72462844..72463139 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAAGTCAATGGCAGCTCTGA Chr9:72459592..72459611 60.14 50 CGTTGGCTGTAGTGCCTTCT Chr9:72463053..72463072 60.45 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000506465 Chr9:72380047..72380787 GAGAGGAACCGTGACGAGAG Chr9:72380371..72380390 59.99 60
upstream ENSMUSE00000311445 Chr9:72424846..72424879 No primer for this exon
upstream ENSMUSE00000311426 Chr9:72439558..72439640 CCTTCAACTGCCTTCTGGTC Chr9:72439602..72439621 59.84 55
upstream ENSMUSE00000311403 Chr9:72441045..72441167 TGTCATCTAGTCGGGCACAG Chr9:72441059..72441078 59.85 55
upstream ENSMUSE00000583990 Chr9:72455430..72455546 CTGCGACAATCTTGGCTACC Chr9:72455436..72455455 60.8 55
upstream ENSMUSE00000583989 Chr9:72458111..72458195 CACTGCCCAACCTTGACTTT Chr9:72458158..72458177 60.15 50
upstream ENSMUSE00000407498 Chr9:72459428..72459635 CAAGTCAATGGCAGCTCTGA Chr9:72459592..72459611 60.14 50

*** Putative Vector Insertion (Chr 9: 72459636 - 72462843) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000583988 Chr9:72462844..72463139 CGTTGGCTGTAGTGCCTTCT Chr9:72463053..72463072 60.45 55
downstream ENSMUSE00000583987 Chr9:72464444..72470744 ACCACGCTCCTTCTTTCTCA Chr9:72470378..72470397 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAAGTCAATGGCAGCTCTGA Chr9:72459593..72459613 60.14 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAAGTCAATGGCAGCTCTGA Chr9:72459593..72459613 60.14 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037674