Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI6014
Trapped Gene
Mcm5 (ENSMUSG00000005410)
Vector Insertion
Chr 8: 77647004 - 77647739
Public Clones CSH530 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 77% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000211201 (Chr8:77646891..77647003 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000211201 (Chr8:77646891..77647003 +)
Downstram Exon
ENSMUSE00000211199 (Chr8:77647740..77647868 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000458205 Chr8:77633468..77633520 No primer for this exon
upstream ENSMUSE00000353943 Chr8:77633599..77633773 No primer for this exon
upstream ENSMUSE00000211208 Chr8:77633989..77634115 No primer for this exon
upstream ENSMUSE00000211204 Chr8:77634199..77634327 No primer for this exon
upstream ENSMUSE00000211203 Chr8:77636443..77636615 No primer for this exon
upstream ENSMUSE00000211206 Chr8:77638064..77638219 No primer for this exon
upstream ENSMUSE00000211205 Chr8:77639751..77639917 No primer for this exon
upstream ENSMUSE00000211202 Chr8:77641421..77641592 No primer for this exon
upstream ENSMUSE00000211194 Chr8:77643156..77643267 No primer for this exon
upstream ENSMUSE00000211196 Chr8:77644679..77644822 No primer for this exon
upstream ENSMUSE00000211198 Chr8:77645111..77645176 No primer for this exon
upstream ENSMUSE00000211197 Chr8:77645437..77645613 No primer for this exon
upstream ENSMUSE00000211201 Chr8:77646891..77647003 No primer for this exon

*** Putative Vector Insertion (Chr 8: 77647004 - 77647739) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000211199 Chr8:77647740..77647868 No primer for this exon
downstream ENSMUSE00000211200 Chr8:77648700..77648842 No primer for this exon
downstream ENSMUSE00000211209 Chr8:77650136..77650263 No primer for this exon
downstream ENSMUSE00000211195 Chr8:77651122..77651587 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GACCTGGCCAAGATGAAGAA Chr8:77646964..77646984 60.19 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GACCTGGCCAAGATGAAGAA Chr8:77646964..77646984 60.19 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000005410