Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI6068
Trapped Gene
Tln1 (ENSMUSG00000028465)
Vector Insertion
Chr 4: 43547451 - 43547638
Public Clones YHD140 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 85% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000413328 (Chr4:43547452..43547637 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CATCCGAATGACCAAGGGTA Chr4:43547568..43547587 60.71 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000413328 (Chr4:43547452..43547637 -)
Downstram Exon
ENSMUSE00000674723 (Chr4:43547452..43547637 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CATCCGAATGACCAAGGGTA Chr4:43547568..43547587 60.71 50 TTCAGGGGTAGAGGTCTTGG Chr4:43547571..43547590 59.13 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000289986 Chr4:43575002..43575127 GAAGTGGCCGAGAGTGTGTC Chr4:43575091..43575110 60.87 60
upstream ENSMUSE00000711522 Chr4:43569493..43569655 ATGTGGTGAAGACGATGCAA Chr4:43569569..43569588 60.12 45
upstream ENSMUSE00000716731 Chr4:43569493..43569655 ATGTGGTGAAGACGATGCAA Chr4:43569569..43569588 60.12 45
upstream ENSMUSE00000179477 Chr4:43569161..43569258 CAACGACTTTGGGCTCTTTC Chr4:43569238..43569257 59.85 50
upstream ENSMUSE00000674764 Chr4:43569161..43569258 CAACGACTTTGGGCTCTTTC Chr4:43569238..43569257 59.85 50
upstream ENSMUSE00000179473 Chr4:43568727..43568856 CAAGACCGTCACAGACATGC Chr4:43568751..43568770 60.32 55
upstream ENSMUSE00000674763 Chr4:43568727..43568856 CAAGACCGTCACAGACATGC Chr4:43568751..43568770 60.32 55
upstream ENSMUSE00000179429 Chr4:43568474..43568626 GGTTCGAGAGCTGATGGAAG Chr4:43568579..43568598 59.95 55
upstream ENSMUSE00000674762 Chr4:43568474..43568626 GGTTCGAGAGCTGATGGAAG Chr4:43568579..43568598 59.95 55
upstream ENSMUSE00000179459 Chr4:43568141..43568283 TGGAAGAGCATGAGACGTTG Chr4:43568222..43568241 59.98 50
upstream ENSMUSE00000674761 Chr4:43568141..43568283 TGGAAGAGCATGAGACGTTG Chr4:43568222..43568241 59.98 50
upstream ENSMUSE00000179446 Chr4:43567919..43568046 GCACGAGATGACATCCTGAA Chr4:43568027..43568046 59.79 50
upstream ENSMUSE00000674760 Chr4:43567919..43568046 GCACGAGATGACATCCTGAA Chr4:43568027..43568046 59.79 50
upstream ENSMUSE00000179474 Chr4:43567150..43567210 GCAGAAGGGAGAGCGTAAGA Chr4:43567158..43567177 59.72 55
upstream ENSMUSE00000674759 Chr4:43567150..43567210 GCAGAAGGGAGAGCGTAAGA Chr4:43567158..43567177 59.72 55
upstream ENSMUSE00000527570 Chr4:43566318..43566422 CCGTTCCCTCAAGACTTACG Chr4:43566341..43566360 59.73 55
upstream ENSMUSE00000674758 Chr4:43566318..43566422 CCGTTCCCTCAAGACTTACG Chr4:43566341..43566360 59.73 55
upstream ENSMUSE00000527569 Chr4:43565858..43566013 GGAGGTGATTCAGGAATGGA Chr4:43565908..43565927 59.86 50
upstream ENSMUSE00000674757 Chr4:43565858..43566013 GGAGGTGATTCAGGAATGGA Chr4:43565908..43565927 59.86 50
upstream ENSMUSE00000179439 Chr4:43564058..43564159 ACAGCTCATTGCTGGCTACA Chr4:43564078..43564097 59.62 50
upstream ENSMUSE00000179441 Chr4:43563834..43563910 AAAAGCAAGGACCATTTTGG Chr4:43563888..43563907 59.06 40
upstream ENSMUSE00000179442 Chr4:43563070..43563250 AGTACAACCGAGTGGGGAAA Chr4:43563211..43563230 59.45 50
upstream ENSMUSE00000179490 Chr4:43562810..43562923 CAGGCCACTCTGGATGACTT Chr4:43562841..43562860 60.26 55
upstream ENSMUSE00000179436 Chr4:43562595..43562703 CCAAAGCTTGGCGTAAGAAC Chr4:43562680..43562699 59.88 50
upstream ENSMUSE00000179470 Chr4:43562193..43562401 TCTTCCAACCTGACGGAGAT Chr4:43562329..43562348 59.65 50
upstream ENSMUSE00000179455 Chr4:43561958..43562056 GTGACACTGACCCCCACTTC Chr4:43561961..43561980 60.42 60
upstream ENSMUSE00000674756 Chr4:43560995..43561018 No primer for this exon
upstream ENSMUSE00000179453 Chr4:43560851..43561018 GCTACGCAATGTGCTCTGTC Chr4:43560879..43560898 59.63 55
upstream ENSMUSE00000179466 Chr4:43560374..43560668 GTCGGTATGACCAAGCCACT Chr4:43560426..43560445 60 55
upstream ENSMUSE00000674755 Chr4:43560374..43560473 GTCGGTATGACCAAGCCACT Chr4:43560426..43560445 60 55
upstream ENSMUSE00000674773 Chr4:43560374..43560518 GTCGGTATGACCAAGCCACT Chr4:43560426..43560445 60 55
upstream ENSMUSE00000674772 Chr4:43559724..43559788 CCTCAGACCTGGTCAATGCT Chr4:43559730..43559749 60.26 55
upstream ENSMUSE00000718914 Chr4:43559622..43559788 CCTCAGACCTGGTCAATGCT Chr4:43559730..43559749 60.26 55
upstream ENSMUSE00000721103 Chr4:43559622..43559788 CCTCAGACCTGGTCAATGCT Chr4:43559730..43559749 60.26 55
upstream ENSMUSE00000179448 Chr4:43558732..43558860 CCTGACAGTGAGGAACAGCA Chr4:43558826..43558845 60.02 55
upstream ENSMUSE00000674753 Chr4:43558732..43558860 CCTGACAGTGAGGAACAGCA Chr4:43558826..43558845 60.02 55
upstream ENSMUSE00000179444 Chr4:43558478..43558594 CCTCTGCAACACAGACCATT Chr4:43558553..43558572 58.72 50
upstream ENSMUSE00000674752 Chr4:43558478..43558594 CCTCTGCAACACAGACCATT Chr4:43558553..43558572 58.72 50
upstream ENSMUSE00000674771 Chr4:43558478..43558519 No primer for this exon
upstream ENSMUSE00000660844 Chr4:43558279..43558392 TGTCCGAGGAAGTCAAGCTC Chr4:43558338..43558357 60.53 55
upstream ENSMUSE00000710922 Chr4:43558279..43558392 TGTCCGAGGAAGTCAAGCTC Chr4:43558338..43558357 60.53 55
upstream ENSMUSE00000720893 Chr4:43558279..43558392 TGTCCGAGGAAGTCAAGCTC Chr4:43558338..43558357 60.53 55
upstream ENSMUSE00000179464 Chr4:43557966..43558100 AGTCAGTGCGCAAAGAACCT Chr4:43558006..43558025 60.06 50
upstream ENSMUSE00000674769 Chr4:43557966..43558100 AGTCAGTGCGCAAAGAACCT Chr4:43558006..43558025 60.06 50
upstream ENSMUSE00000179438 Chr4:43557713..43557841 TGGAGATGGATTCTGCACTG Chr4:43557800..43557819 59.79 50
upstream ENSMUSE00000674767 Chr4:43557713..43557841 TGGAGATGGATTCTGCACTG Chr4:43557800..43557819 59.79 50
upstream ENSMUSE00000179472 Chr4:43557448..43557550 CCCAGGGCAATGAGAACTAT Chr4:43557452..43557471 59.01 50
upstream ENSMUSE00000674766 Chr4:43557448..43557550 CCCAGGGCAATGAGAACTAT Chr4:43557452..43557471 59.01 50
upstream ENSMUSE00000674765 Chr4:43557175..43557360 TATTGCAGCTCGGGATGTAG Chr4:43557340..43557359 58.9 50
upstream ENSMUSE00000179430 Chr4:43557152..43557360 No primer for this exon
upstream ENSMUSE00000674750 Chr4:43557152..43557360 No primer for this exon
upstream ENSMUSE00000179481 Chr4:43556689..43556808 GGCCAAAGAGACGTGGATAA Chr4:43556738..43556757 60.07 50
upstream ENSMUSE00000674749 Chr4:43556689..43556808 GGCCAAAGAGACGTGGATAA Chr4:43556738..43556757 60.07 50
upstream ENSMUSE00000179451 Chr4:43556308..43556505 CACAGAGCCGATTGAATGAA Chr4:43556455..43556474 59.8 45
upstream ENSMUSE00000674748 Chr4:43556308..43556505 CACAGAGCCGATTGAATGAA Chr4:43556455..43556474 59.8 45
upstream ENSMUSE00000179433 Chr4:43556016..43556155 TCCAACCTGAAGGGCATATC Chr4:43556109..43556128 59.89 50
upstream ENSMUSE00000674747 Chr4:43556016..43556155 TCCAACCTGAAGGGCATATC Chr4:43556109..43556128 59.89 50
upstream ENSMUSE00000179463 Chr4:43555747..43555840 CAGTGACGGACAGCATCAAC Chr4:43555819..43555838 60.32 55
upstream ENSMUSE00000674746 Chr4:43555747..43555840 CAGTGACGGACAGCATCAAC Chr4:43555819..43555838 60.32 55
upstream ENSMUSE00000179435 Chr4:43555574..43555663 CCTACTTCGGTTGCTTGGAC Chr4:43555595..43555614 59.73 55
upstream ENSMUSE00000674744 Chr4:43555574..43555663 CCTACTTCGGTTGCTTGGAC Chr4:43555595..43555614 59.73 55
upstream ENSMUSE00000179479 Chr4:43555353..43555475 TCCTAGGTGAGGCCATGACT Chr4:43555455..43555474 59.68 55
upstream ENSMUSE00000674743 Chr4:43555353..43555475 TCCTAGGTGAGGCCATGACT Chr4:43555455..43555474 59.68 55
upstream ENSMUSE00000179488 Chr4:43553402..43553545 ACAGCAAGGACTGGTGGAAC Chr4:43553482..43553501 60.16 55
upstream ENSMUSE00000674742 Chr4:43553402..43553545 ACAGCAAGGACTGGTGGAAC Chr4:43553482..43553501 60.16 55
upstream ENSMUSE00000179469 Chr4:43552848..43553009 AGCGCCAGTTTGTACAGTCA Chr4:43552896..43552915 59.51 50
upstream ENSMUSE00000674740 Chr4:43552848..43553009 AGCGCCAGTTTGTACAGTCA Chr4:43552896..43552915 59.51 50
upstream ENSMUSE00000179485 Chr4:43552509..43552649 TCTGCTGGAAGCTGTGGATA Chr4:43552571..43552590 59.55 50
upstream ENSMUSE00000674739 Chr4:43552509..43552649 TCTGCTGGAAGCTGTGGATA Chr4:43552571..43552590 59.55 50
upstream ENSMUSE00000179482 Chr4:43552238..43552419 TAGCAGTCAATCCCCGAGAC Chr4:43552315..43552334 60.22 55
upstream ENSMUSE00000674738 Chr4:43552238..43552419 TAGCAGTCAATCCCCGAGAC Chr4:43552315..43552334 60.22 55
upstream ENSMUSE00000179487 Chr4:43551963..43552095 CCTAGATCAGGCTTCGCTTG Chr4:43552010..43552029 60.11 55
upstream ENSMUSE00000674737 Chr4:43551963..43552095 CCTAGATCAGGCTTCGCTTG Chr4:43552010..43552029 60.11 55
upstream ENSMUSE00000179458 Chr4:43551550..43551651 No primer for this exon
upstream ENSMUSE00000674735 Chr4:43551550..43551651 No primer for this exon
upstream ENSMUSE00000179484 Chr4:43551304..43551474 CTGCGTCTAAGACCCTGAGC Chr4:43551403..43551422 60.16 60
upstream ENSMUSE00000674733 Chr4:43551304..43551474 CTGCGTCTAAGACCCTGAGC Chr4:43551403..43551422 60.16 60
upstream ENSMUSE00000179462 Chr4:43551062..43551211 CAGAGGCCGTAGAAGACCTG Chr4:43551143..43551162 60.01 60
upstream ENSMUSE00000674732 Chr4:43551062..43551211 CAGAGGCCGTAGAAGACCTG Chr4:43551143..43551162 60.01 60
upstream ENSMUSE00000179461 Chr4:43550858..43550959 CCCAGAAGGCTCATTCGTAG Chr4:43550917..43550936 59.83 55
upstream ENSMUSE00000674731 Chr4:43550858..43550959 CCCAGAAGGCTCATTCGTAG Chr4:43550917..43550936 59.83 55
upstream ENSMUSE00000179471 Chr4:43550660..43550779 CCTGAAGAGCTAGGCCCTCT Chr4:43550739..43550758 60.11 60
upstream ENSMUSE00000674730 Chr4:43550660..43550779 CCTGAAGAGCTAGGCCCTCT Chr4:43550739..43550758 60.11 60
upstream ENSMUSE00000179447 Chr4:43549396..43549542 TAGGCGCTCACATCAAACAC Chr4:43549522..43549541 59.87 50
upstream ENSMUSE00000674728 Chr4:43549396..43549542 TAGGCGCTCACATCAAACAC Chr4:43549522..43549541 59.87 50
upstream ENSMUSE00000179475 Chr4:43549116..43549282 ACTTAACCGTGAGGGTGCTG Chr4:43549135..43549154 60.17 55
upstream ENSMUSE00000674727 Chr4:43549116..43549282 ACTTAACCGTGAGGGTGCTG Chr4:43549135..43549154 60.17 55
upstream ENSMUSE00000289719 Chr4:43548825..43549008 AGCCGAAGACCCTGAAACTC Chr4:43548827..43548846 60.77 55
upstream ENSMUSE00000674726 Chr4:43548825..43549008 AGCCGAAGACCCTGAAACTC Chr4:43548827..43548846 60.77 55
upstream ENSMUSE00000289709 Chr4:43548610..43548735 GGTGACCTCATCAGCGCTAC Chr4:43548674..43548693 60.83 60
upstream ENSMUSE00000674725 Chr4:43548610..43548735 GGTGACCTCATCAGCGCTAC Chr4:43548674..43548693 60.83 60
upstream ENSMUSE00000354369 Chr4:43548392..43548508 GCAACCACAGAGCACATACG Chr4:43548405..43548424 60.33 55
upstream ENSMUSE00000674724 Chr4:43548392..43548508 GCAACCACAGAGCACATACG Chr4:43548405..43548424 60.33 55
upstream ENSMUSE00000413328 Chr4:43547452..43547637 CATCCGAATGACCAAGGGTA Chr4:43547568..43547587 60.71 50
upstream ENSMUSE00000674723 Chr4:43547452..43547637 CATCCGAATGACCAAGGGTA Chr4:43547568..43547587 60.71 50

*** Putative Vector Insertion (Chr 4: 43547451 - 43547638) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000372500 Chr4:43547262..43547369 GTACATCAGGCGCCACTTCT Chr4:43547311..43547330 60.28 55
downstream ENSMUSE00000674722 Chr4:43547262..43547369 GTACATCAGGCGCCACTTCT Chr4:43547311..43547330 60.28 55
downstream ENSMUSE00000403999 Chr4:43546735..43546840 TCCAGTTAGCTGCTGCTTCA Chr4:43546774..43546793 59.89 50
downstream ENSMUSE00000674721 Chr4:43546735..43546840 TCCAGTTAGCTGCTGCTTCA Chr4:43546774..43546793 59.89 50
downstream ENSMUSE00000179486 Chr4:43546426..43546550 TTCAGCTGCTCCAGCTTCTT Chr4:43546423..43546442 60.42 50
downstream ENSMUSE00000674719 Chr4:43546426..43546550 TTCAGCTGCTCCAGCTTCTT Chr4:43546423..43546442 60.42 50
downstream ENSMUSE00000179457 Chr4:43546176..43546301 CTGACGCAGCCTTTACCAGT Chr4:43546186..43546205 60.45 55
downstream ENSMUSE00000674718 Chr4:43546176..43546301 CTGACGCAGCCTTTACCAGT Chr4:43546186..43546205 60.45 55
downstream ENSMUSE00000179460 Chr4:43545998..43546060 ACCACTGCCCATCATCCAGT Chr4:43545996..43546015 62.76 55
downstream ENSMUSE00000674717 Chr4:43545998..43546060 ACCACTGCCCATCATCCAGT Chr4:43545996..43546015 62.76 55
downstream ENSMUSE00000179428 Chr4:43545702..43545884 CTGCGTTAGCTGCTTCACAC Chr4:43545811..43545830 59.81 55
downstream ENSMUSE00000674716 Chr4:43545702..43545884 CTGCGTTAGCTGCTTCACAC Chr4:43545811..43545830 59.81 55
downstream ENSMUSE00000179450 Chr4:43545064..43545192 CACCACCGTCTCATTCTCCT Chr4:43545075..43545094 60.11 55
downstream ENSMUSE00000674715 Chr4:43545064..43545192 CACCACCGTCTCATTCTCCT Chr4:43545075..43545094 60.11 55
downstream ENSMUSE00000347950 Chr4:43544393..43544957 TGGGTTTACAACCCTCAAGC Chr4:43544401..43544420 59.97 50
downstream ENSMUSE00000660843 Chr4:43544393..43544957 TGGGTTTACAACCCTCAAGC Chr4:43544401..43544420 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTTCCCATCTTGGACACCAT Chr4:43547664..43547684 59.78 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTTCCCATCTTGGACACCAT Chr4:43547664..43547684 59.78 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028465