Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI6070
Trapped Gene
Urm1 (ENSMUSG00000069020)
Vector Insertion
Chr 2: 29688283 - 29696921
Public Clones (sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
YHD146 (baygenomics) M121G08 (ggtc) E121D09 (ggtc) D079F10 (ggtc)
(ggtc) W269B07 (ggtc) D178E03 (ggtc) D050B06 (ggtc) (ggtc)
(ggtc) D102C06 (ggtc) (ggtc) (ggtc) Q015C05 (ggtc) E061F06 (ggtc)
D079F10 (ggtc) (ggtc) (ggtc) W189F03 (ggtc) D123A12 (ggtc) (ggtc)
(ggtc) P102G06 (ggtc) D102C06 (ggtc) (ggtc) Q009F02 (ggtc) E030B08 (ggtc)
D050B06 (ggtc) (ggtc) (ggtc) M069C06 (ggtc) D110G05 (ggtc) (ggtc)
(ggtc) CMHD-GT_430G10-3 (cmhd) CMHD-GT_326E12-3 (cmhd) CMHD-GT_407C3-3 (cmhd)
CMHD-GT_536G7-5S (cmhd) IST13182B1 (tigm) IST11447G1 (tigm) IST13182A1 (tigm)
IST14935G9 (tigm) IST10895E12 (tigm) IST14223F6 (tigm) IST14374E7 (tigm)
IST10929H2 (tigm) IST10834C10 (tigm) IST10728F2 (tigm) IST14652H1 (tigm)
IST10902E4 (tigm) IST10103D12 (tigm) IST14232B9 (tigm) IST13035D10 (tigm)
IST10091C5 (tigm) IST14367C3 (tigm) IST14386F7 (tigm)
Private Clones OST459561 (lexicon) OST455481 (lexicon) OST455117 (lexicon) OST452189 (lexicon)
OST447291 (lexicon) OST432005 (lexicon) OST428510 (lexicon) OST418869 (lexicon)
OST415919 (lexicon) OST406910 (lexicon) OST406461 (lexicon) OST406076 (lexicon)
OST403403 (lexicon) OST366929 (lexicon) OST358818 (lexicon) OST341104 (lexicon)
OST334770 (lexicon) OST317756 (lexicon) OST310111 (lexicon) OST307323 (lexicon)
OST302123 (lexicon) OST300561 (lexicon) OST297466 (lexicon) OST295643 (lexicon)
OST295607 (lexicon) OST288867 (lexicon) OST288828 (lexicon) OST285419 (lexicon)
OST281055 (lexicon) OST279195 (lexicon) OST274162 (lexicon) OST274106 (lexicon)
OST273753 (lexicon) OST269954 (lexicon) OST253330 (lexicon) OST252529 (lexicon)
OST252464 (lexicon) OST240882 (lexicon) OST240583 (lexicon) OST232369 (lexicon)
OST207273 (lexicon) OST198700 (lexicon) OST195404 (lexicon) OST192696 (lexicon)
OST189063 (lexicon) OST173544 (lexicon) OST170491 (lexicon) OST167094 (lexicon)
OST166842 (lexicon) OST149100 (lexicon) OST136022 (lexicon) OST126907 (lexicon)
OST126762 (lexicon) OST122685 (lexicon) OST118054 (lexicon) OST116469 (lexicon)
OST98217 (lexicon) OST81195 (lexicon) OST79410 (lexicon) OST68277 (lexicon)
OST54680 (lexicon) OST54491 (lexicon) OST44734 (lexicon) OST43299 (lexicon)
OST41617 (lexicon) OST41384 (lexicon) OST41157 (lexicon) OST41130 (lexicon)
OST40537 (lexicon) OST30640 (lexicon)
Severity of mutation (?) Insertion after 36% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000568262 (Chr2:29688212..29688282 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCTCCTGTTTGATGGGGTAA Chr2:29688224..29688243 59.93 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000568262 (Chr2:29688212..29688282 +)
Downstram Exon
ENSMUSE00000568261 (Chr2:29696922..29697003 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCTCCTGTTTGATGGGGTAA Chr2:29688224..29688243 59.93 50 GAACAGCTCTGGTCGCTCTT Chr2:29696989..29697008 59.75 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000568263 Chr2:29682904..29682955 CGCCCTTATGTGTGAAGGTG Chr2:29682928..29682947 61.48 55
upstream ENSMUSE00000568262 Chr2:29688212..29688282 GCTCCTGTTTGATGGGGTAA Chr2:29688224..29688243 59.93 50

*** Putative Vector Insertion (Chr 2: 29688283 - 29696921) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000568261 Chr2:29696922..29697003 GAACAGCTCTGGTCGCTCTT Chr2:29696989..29697008 59.75 55
downstream ENSMUSE00000568260 Chr2:29698241..29698289 GTTCCCAGTCGGCATCATTA Chr2:29698287..29698306 60.86 50
downstream ENSMUSE00000568259 Chr2:29698623..29699582 GAGTTGTAGGCAGCCTGGAG Chr2:29699372..29699391 60.01 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCTCCATTCTTACCCCCATT Chr2:29691264..29691284 60.15 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCTCCATTCTTACCCCCATT Chr2:29691264..29691284 60.15 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000069020