Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI6101
Trapped Gene
Dmd (ENSMUSG00000045103)
Vector Insertion
Chr X: 82299372 - 82335155
Public Clones (sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) (sanger) YHD235 (baygenomics) HMA421 (baygenomics) E093H06 (ggtc)
D110F05 (ggtc) E048E11 (ggtc) (ggtc) E125H09 (ggtc) D177H08 (ggtc)
E093H06 (ggtc) D081F07 (ggtc) E045F10 (ggtc) (ggtc) E093H07 (ggtc)
D177G07 (ggtc) E048E11 (ggtc) D005A07 (ggtc) (ggtc) E043E12 (ggtc)
(ggtc) CMHD-GT_537F2-3 (cmhd) CMHD-GT_351C12-3 (cmhd) (cmhd)
CMHD-GT_341A4-3 (cmhd) CMHD-GT_537F2-5S (cmhd) CMHD-GT_329G9-3 (cmhd) IST14783D11 (tigm)
IST10190D12 (tigm) IST14802F4 (tigm) IST12301C11 (tigm) IST15065G4 (tigm)
IST12022G1 (tigm) IST12409A6 (tigm) IST10190D12 (tigm) IST15097G1 (tigm)
IST11807H5 (tigm) IST12539C12 (tigm) IST10118H7 (tigm) IST11785F11 (tigm)
IST14706B6 (tigm) IST10982A2 (tigm) IST13031A3 (tigm) IST11969B11 (tigm)
IST11785F11 (tigm) IST11807H5 (tigm) IST11608B5 (tigm)
Private Clones OST472718 (lexicon) OST285335 (lexicon) OST283399 (lexicon) OST261937 (lexicon)
OST253426 (lexicon) OST104421 (lexicon) OST77156 (lexicon) OST68336 (lexicon)
OST63600 (lexicon) OST37154 (lexicon)
Severity of mutation (?) Insertion after 5% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000303684 (ChrX:82299310..82299371 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACGAGACCCAAACCACTTGT ChrX:82299312..82299331 59.47 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000303684 (ChrX:82299310..82299371 +)
Downstram Exon
ENSMUSE00000303678 (ChrX:82335156..82335230 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACGAGACCCAAACCACTTGT ChrX:82299312..82299331 59.47 50 CGCGGAGAACCTGACATTAT ChrX:82335187..82335206 60.1 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000697740 ChrX:80194242..80194486 TTGCCCCTTACAGGACTCAG ChrX:80194251..80194270 60.25 55
upstream ENSMUSE00000550618 ChrX:80381967..80382028 TCACAAAATGGATAAATGCACA ChrX:80381997..80382018 58.94 31.82
upstream ENSMUSE00000304148 ChrX:80591601..80591693 GGAAAACGCCTCCTAGACCT ChrX:80591646..80591665 59.71 55
upstream ENSMUSE00000304146 ChrX:80596765..80596842 CACTGCGGGTCTTACAGAAA ChrX:80596817..80596836 58.92 50
upstream ENSMUSE00000550616 ChrX:80620398..80620490 No primer for this exon
upstream ENSMUSE00000697668 ChrX:80620398..80620454 No primer for this exon
upstream ENSMUSE00000463420 ChrX:80626524..80626696 ATTGCAGCAAACCAACAGTG ChrX:80626556..80626575 59.76 45
upstream ENSMUSE00000460512 ChrX:80735166..80735284 CACTCAGCCACCCAAAGACT ChrX:80735203..80735222 60.3 55
upstream ENSMUSE00000697667 ChrX:80872600..80872785 TTTTGCCACAACAAGTGAGC ChrX:80872664..80872683 59.89 45
upstream ENSMUSE00000304130 ChrX:80872601..80872785 TTTTGCCACAACAAGTGAGC ChrX:80872664..80872683 59.89 45
upstream ENSMUSE00000304124 ChrX:80873906..80874037 CAGAGCCCCTATCCTTCACA ChrX:80874017..80874036 60.21 55
upstream ENSMUSE00000304118 ChrX:80909387..80909575 TACATTGCGAGCACAAGGAG ChrX:80909506..80909525 60.01 50
upstream ENSMUSE00000420937 ChrX:80910387..80910568 TGGGAATGTCTCAGGGTAGC ChrX:80910528..80910547 60.07 55
upstream ENSMUSE00000420934 ChrX:80923618..80923768 CCCTTTGGACCTGATCTTGA ChrX:80923718..80923737 60.04 50
upstream ENSMUSE00000420930 ChrX:80937107..80937226 GGTCAACTCGCTCACTCACA ChrX:80937142..80937161 60.03 55
upstream ENSMUSE00000304096 ChrX:80959442..80959543 CTGAAGACCGCTGGATTGTT ChrX:80959479..80959498 60.26 50
upstream ENSMUSE00000147703 ChrX:80959639..80959746 TGCAATGAAGAACATTCAGACA ChrX:80959674..80959695 59.32 36.36
upstream ENSMUSE00000147701 ChrX:80967207..80967386 AAAAGCCAACCATGGAAAAA ChrX:80967232..80967251 59.43 35
upstream ENSMUSE00000147716 ChrX:80974660..80974835 AAGAGGAACTTCCACCACCA ChrX:80974766..80974785 59.55 50
upstream ENSMUSE00000420912 ChrX:81000716..81000839 CGAAAAGAAGGCAACATCTCA ChrX:81000798..81000818 60.37 42.86
upstream ENSMUSE00000420943 ChrX:81017874..81017961 GCCATAGCACGAGAAAAAGC ChrX:81017874..81017893 59.99 50
upstream ENSMUSE00000420910 ChrX:81026868..81027109 TGCCAATTGCTGAGTGAGAG ChrX:81026933..81026952 60.14 50
upstream ENSMUSE00000420907 ChrX:81031474..81031654 GTGTGAGGGCCAAAGAGAAA ChrX:81031622..81031641 60.23 50
upstream ENSMUSE00000147695 ChrX:81047586..81047731 TTACCACCAATGCGCTATCA ChrX:81047597..81047616 60.1 45
upstream ENSMUSE00000147700 ChrX:81048645..81048857 GAAGAGATTGAGGGGCACTG ChrX:81048762..81048781 59.8 55
upstream ENSMUSE00000147712 ChrX:81051465..81051578 TGGATGGCTGAAGTTGATGT ChrX:81051489..81051508 59.09 45
upstream ENSMUSE00000147708 ChrX:81052675..81052830 TGTTAATGAAGGTGGGCAGA ChrX:81052719..81052738 59.12 45
upstream ENSMUSE00000147693 ChrX:81058814..81058984 AAAACCGTAAGCCTCCAAAAA ChrX:81058853..81058873 59.99 38.1
upstream ENSMUSE00000420887 ChrX:81063471..81063653 ACCAGGCTGAATGGAAAATG ChrX:81063621..81063640 59.93 45
upstream ENSMUSE00000147711 ChrX:81073294..81073428 GAAAGCAAACAAGTGGCTCA ChrX:81073335..81073354 59.05 45
upstream ENSMUSE00000147684 ChrX:81075759..81075908 TTCTCGTTGGAGGGAACTACA ChrX:81075881..81075901 59.72 47.62
upstream ENSMUSE00000697661 ChrX:81100746..81100935 GCTCGAAAGCTACGCAATCT ChrX:81100903..81100922 59.76 50
upstream ENSMUSE00000420879 ChrX:81101045..81101206 AAGGTGGATGCAGCTCAAAT ChrX:81101171..81101190 59.7 45
upstream ENSMUSE00000481398 ChrX:81123386..81123496 CCAACCAAAGGGTTCTTTCA ChrX:81123459..81123478 59.94 45
upstream ENSMUSE00000482384 ChrX:81123815..81123988 TTCCAAAAACCAGCCAATTT ChrX:81123851..81123870 59.43 35
upstream ENSMUSE00000475896 ChrX:81126618..81126773 TGATTAAAACCGGACGTCAA ChrX:81126664..81126683 59.01 40
upstream ENSMUSE00000476701 ChrX:81132402..81132572 TGCTTGAAGTTGTCCCGTAA ChrX:81132432..81132451 59.32 45
upstream ENSMUSE00000697660 ChrX:81132402..81132476 TGCTTGAAGTTGTCCCGTAA ChrX:81132432..81132451 59.32 45
upstream ENSMUSE00000477886 ChrX:81150287..81150466 TGTTGGGCAAGAAAGAAACC ChrX:81150363..81150382 60.09 45
upstream ENSMUSE00000478694 ChrX:81151328..81151456 CAAAGTGGATCATTCATGCAG ChrX:81151377..81151397 59.14 42.86
upstream ENSMUSE00000503921 ChrX:81153720..81153890 CCGTCGATTTGCAGCTATTT ChrX:81153848..81153867 60.23 45
upstream ENSMUSE00000493132 ChrX:81167806..81167928 ATTCAGCAGGGGGTGAATCT ChrX:81167881..81167900 60.85 50
upstream ENSMUSE00000505962 ChrX:81170191..81170328 No primer for this exon
upstream ENSMUSE00000502907 ChrX:81173184..81173336 CAGCCTACCTGAACCCAGAG ChrX:81173300..81173319 59.86 60
upstream ENSMUSE00000500339 ChrX:81174142..81174324 GCAGTGGAGCCAACTCAGAT ChrX:81174232..81174251 60.42 55
upstream ENSMUSE00000504919 ChrX:81200302..81200496 ACGACTGAAGATATGCCTTTGG ChrX:81200332..81200353 60.5 45.46
upstream ENSMUSE00000502416 ChrX:81210008..81210180 CCTCCATGGAAAAGGTGAAA ChrX:81210090..81210109 59.9 45
upstream ENSMUSE00000499333 ChrX:81267604..81267751 CAGTTGAAAAATGGCGACAC ChrX:81267618..81267637 59.17 45
upstream ENSMUSE00000495780 ChrX:81517291..81517466 ACTGAATGCAACTGGGGAAG ChrX:81517335..81517354 60.11 50
upstream ENSMUSE00000517700 ChrX:81555138..81555279 GTTTTGTGGCTGGAAGAAGC ChrX:81555193..81555212 59.86 50
upstream ENSMUSE00000550588 ChrX:81557816..81557965 GCGCCAGGGAATTCTAAAAC ChrX:81557839..81557858 60.93 50
upstream ENSMUSE00000497360 ChrX:81618722..81618886 AGGCAGGACCGTTTGACATA ChrX:81618864..81618883 60.52 50
upstream ENSMUSE00000493823 ChrX:81671047..81671148 AAACAAGCGGATGTGGAAAG ChrX:81671071..81671090 60.11 45
upstream ENSMUSE00000508192 ChrX:81677223..81677331 CCATTTACTTCGGGAGCTGA ChrX:81677264..81677283 60.21 50
upstream ENSMUSE00000509205 ChrX:81719473..81719705 GACTTCAACCGAGCTTGGAC ChrX:81719583..81719602 59.85 55
upstream ENSMUSE00000517903 ChrX:81777213..81777330 GCTGCCCAGAATTTGAAAAA ChrX:81777267..81777286 60.19 40
upstream ENSMUSE00000519874 ChrX:81820899..81821110 GAAGCCGAACAGGTCATAGG ChrX:81821009..81821028 59.69 55
upstream ENSMUSE00000514362 ChrX:81844435..81844589 TCCGTCAACGGCAGATAAGT ChrX:81844451..81844470 60.66 50
upstream ENSMUSE00000515366 ChrX:81892376..81892565 CCTGGATTACGGAAGCAGAA ChrX:81892456..81892475 60.21 50
upstream ENSMUSE00000654811 ChrX:82018050..82018245 CCGGTTCAAGCTGAAAATGT ChrX:82018200..82018219 60.11 45
upstream ENSMUSE00000475256 ChrX:82018921..82019093 GCACCCCTGTTACAAAGACG ChrX:82019017..82019036 60.55 55
upstream ENSMUSE00000472426 ChrX:82027258..82027414 GTGGAAGCGTTTGCATCTTT ChrX:82027285..82027304 60.26 45
upstream ENSMUSE00000469376 ChrX:82062637..82062757 GCCTTCAAGAGGGAATTGAA ChrX:82062637..82062656 59.24 45
upstream ENSMUSE00000474229 ChrX:82063366..82063634 AATGTCACTCGGCTCCTACG ChrX:82063392..82063411 60.28 55
upstream ENSMUSE00000471641 ChrX:82093987..82094133 ACATCAGCTGACCACACTGG ChrX:82094046..82094065 59.74 55
upstream ENSMUSE00000468801 ChrX:82189484..82189562 No primer for this exon
upstream ENSMUSE00000511910 ChrX:82220044..82220104 TCACCAAACAAAGTGCCCTAC ChrX:82220076..82220096 60.02 47.62
upstream ENSMUSE00000706981 ChrX:82220044..82221046 GTTTTGGAGGGTGAGCAGAA ChrX:82220301..82220320 60.23 50
upstream ENSMUSE00000697656 ChrX:82293752..82293798 TGCCTGTGAAACCCTTACAA ChrX:82293757..82293776 59.17 45
upstream ENSMUSE00000717676 ChrX:82293752..82293798 TGCCTGTGAAACCCTTACAA ChrX:82293757..82293776 59.17 45
upstream ENSMUSE00000303684 ChrX:82299310..82299371 ACGAGACCCAAACCACTTGT ChrX:82299312..82299331 59.47 50

*** Putative Vector Insertion (Chr X: 82299372 - 82335155) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000303678 ChrX:82335156..82335230 CGCGGAGAACCTGACATTAT ChrX:82335187..82335206 60.1 50
downstream ENSMUSE00000147657 ChrX:82350483..82350684 TTGTTGTGCTCTTGCTCCAG ChrX:82350624..82350643 60.17 50
downstream ENSMUSE00000147670 ChrX:82352919..82353004 No primer for this exon
downstream ENSMUSE00000147675 ChrX:82355282..82355439 TTGAACTTGCCACTTGCTTG ChrX:82355311..82355330 60.03 45
downstream ENSMUSE00000381257 ChrX:82384667..82384833 CTTGATGCTTGGCAGTTTCA ChrX:82384793..82384812 59.99 45
downstream ENSMUSE00000147673 ChrX:82387065..82387176 TTTTATGGCCCTTTGCAACT ChrX:82387147..82387166 59.59 40
downstream ENSMUSE00000147668 ChrX:82389368..82389504 TTCCATGTTGTCCCCCTCTA ChrX:82389505..82389524 60.31 50
downstream ENSMUSE00000462409 ChrX:82390250..82390288 CTGGCCAGAAGTTGATCAGAG ChrX:82390280..82390300 60 52.38
downstream ENSMUSE00000147666 ChrX:82394469..82394534 TGCGTGAATGAGTATCATCG ChrX:82394518..82394537 58.23 45
downstream ENSMUSE00000147664 ChrX:82395552..82395617 TTGCTGTTTTCCATTTCTGC ChrX:82395578..82395597 58.9 40
downstream ENSMUSE00000147676 ChrX:82398366..82398524 GGGGAGTCCTGGTTCAAACT ChrX:82398425..82398444 60.35 55
downstream ENSMUSE00000147661 ChrX:82423043..82423286 AGAGGTGGGCATCATCTCAG ChrX:82423139..82423158 60.22 55
downstream ENSMUSE00000147659 ChrX:82424038..82424161 AACCACTCGGAGCAGCATAG ChrX:82424139..82424158 60.42 55
downstream ENSMUSE00000147655 ChrX:82435949..82436041 AGGAGTTGTTGAGTTGCTCCA ChrX:82436028..82436048 59.9 47.62
downstream ENSMUSE00000465159 ChrX:82442843..82442874 No primer for this exon
downstream ENSMUSE00000706982 ChrX:82442843..82442883 No primer for this exon
downstream ENSMUSE00000697655 ChrX:82447810..82450378 GTTTGGAGACGCTTTTGCTC ChrX:82449383..82449402 60 50
downstream ENSMUSE00000697670 ChrX:82447810..82451480 GTTTGGAGACGCTTTTGCTC ChrX:82449383..82449402 60 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGCCAAAAATGGTGGTCATA ChrX:82332351..82332371 59.79 40 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGCCAAAAATGGTGGTCATA ChrX:82332351..82332371 59.79 40 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000045103