Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI6148
Trapped Gene
1110014N23Rik (ENSMUSG00000024797)
Vector Insertion
Chr 19: 6076493 - 6076950
Public Clones CSG037 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 10% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000343025 (Chr19:6076951..6077187 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CACTTCGACCCGGAAGTTTA Chr19:6076961..6076980 60.1 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000343025 (Chr19:6076951..6077187 -)
Downstram Exon
ENSMUSE00000644022 (Chr19:6076363..6076492 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CACTTCGACCCGGAAGTTTA Chr19:6076961..6076980 60.1 50 TCCGTCTCACTGTCCATCAG Chr19:6076424..6076443 59.82 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000343025 Chr19:6076951..6077187 CACTTCGACCCGGAAGTTTA Chr19:6076961..6076980 60.1 50

*** Putative Vector Insertion (Chr 19: 6076493 - 6076950) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000644022 Chr19:6076363..6076492 TCCGTCTCACTGTCCATCAG Chr19:6076424..6076443 59.82 55
downstream ENSMUSE00000644021 Chr19:6071562..6071708 TTGGTGATCACTGCCATGTT Chr19:6071602..6071621 59.97 45
downstream ENSMUSE00000644020 Chr19:6071266..6071485 GGCAGCTCAAAAAGGAACTG Chr19:6071418..6071437 59.99 50
downstream ENSMUSE00000644019 Chr19:6070439..6071156 CGCTCAACCAGTGCAAAGTA Chr19:6070799..6070818 60.05 50
downstream ENSMUSE00000644018 Chr19:6069858..6070073 GGAGATGGTGGCTGTCTCAT Chr19:6069875..6069894 60.08 55
downstream ENSMUSE00000644016 Chr19:6069465..6069683 ACAGTGTGCTCACGGGTGTA Chr19:6069628..6069647 60.23 55
downstream ENSMUSE00000644015 Chr19:6069026..6069147 TCCGGACACCCTCTTCATAC Chr19:6069095..6069114 59.93 55
downstream ENSMUSE00000644014 Chr19:6068855..6068942 CACATCGATCCGTTCAGAGA Chr19:6068857..6068876 59.79 50
downstream ENSMUSE00000644013 Chr19:6067842..6068375 CACAAAGCGCCACAAGTAAA Chr19:6068213..6068232 59.91 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TATAATCGCCTTGCAGCACA Chr19:6076881..6076901 60.38 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGGTCCAGACCCCAAATATC Chr19:6076909..6076929 60.39 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024797